ID: 908727486

View in Genome Browser
Species Human (GRCh38)
Location 1:67192448-67192470
Sequence CTGTAAATAGAGATAATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908727486_908727487 -9 Left 908727486 1:67192448-67192470 CCTTTTATTATCTCTATTTACAG 0: 1
1: 0
2: 2
3: 39
4: 499
Right 908727487 1:67192462-67192484 TATTTACAGTCATTACCTAAAGG 0: 1
1: 0
2: 2
3: 11
4: 215
908727486_908727489 10 Left 908727486 1:67192448-67192470 CCTTTTATTATCTCTATTTACAG 0: 1
1: 0
2: 2
3: 39
4: 499
Right 908727489 1:67192481-67192503 AAGGATAGCCTTCAAATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908727486 Original CRISPR CTGTAAATAGAGATAATAAA AGG (reversed) Intronic
900033103 1:385464-385486 CTGGAGTTAGAGATAATGAAAGG - Intergenic
900053944 1:615354-615376 CTGGAGTTAGAGATAATGAAAGG - Intergenic
901037562 1:6345463-6345485 CTGTAAACACAGATAATAAATGG + Intronic
901746320 1:11376097-11376119 CAGGAGATGGAGATAATAAAAGG - Intergenic
902665335 1:17933715-17933737 CTCTGAATAGTAATAATAAATGG - Intergenic
907080704 1:51618752-51618774 CTGTAACTGGGGATATTAAATGG - Intronic
907172339 1:52480031-52480053 ATCTAAGTAGAGACAATAAATGG + Intronic
907235121 1:53039351-53039373 CTGTAAATGGGCTTAATAAATGG + Intronic
908009442 1:59761131-59761153 CTGTAAATGGGGATAATTATGGG - Intronic
908286327 1:62607655-62607677 CTGTAACTCCAGACAATAAAAGG - Intronic
908528982 1:65015455-65015477 CTATAAACAGAGTTAAAAAAAGG + Intergenic
908604390 1:65779008-65779030 CTGTAAATAGAGACAAAGAAGGG + Intergenic
908642358 1:66239322-66239344 CTGTATGTAGACATTATAAAGGG - Intronic
908727486 1:67192448-67192470 CTGTAAATAGAGATAATAAAAGG - Intronic
910009457 1:82443170-82443192 CTGAAAGTACAGATATTAAATGG + Intergenic
910021114 1:82590910-82590932 CTAAAAATAGAGATAGTACAGGG + Intergenic
910075915 1:83278649-83278671 CTGAAAATAGAGATAGTAGGTGG + Intergenic
910419869 1:87047187-87047209 TTGTCATTAGAGAAAATAAAAGG - Intronic
910828951 1:91440407-91440429 ATGAAAATAGAGCTTATAAATGG + Intergenic
911098001 1:94071003-94071025 CTGTAAATGGAGGCCATAAATGG + Intronic
911818607 1:102386817-102386839 CTTTAAATAAATATAAAAAAGGG + Intergenic
912028656 1:105210815-105210837 CTGAAAACAGAAATAAGAAAAGG + Intergenic
912696255 1:111844333-111844355 ATGGAAATAGGAATAATAAAAGG - Intronic
913019350 1:114771642-114771664 AATTCAATAGAGATAATAAATGG - Exonic
913420439 1:118661394-118661416 CTATAAATAGCTATAAAAAATGG + Intergenic
915945152 1:160144318-160144340 CTGTTAAGAGTCATAATAAAGGG - Intergenic
917247287 1:173017822-173017844 CTATAAAATGGGATAATAAAAGG + Intergenic
917573781 1:176297774-176297796 CAGTAAAGAAAGATAATGAAGGG - Intergenic
917637415 1:176950502-176950524 CTCTAAATAGGGATAATATAGGG - Intronic
918451770 1:184665375-184665397 CTGTAAAATGAGATAACACATGG - Intergenic
918533097 1:185544839-185544861 CTTAAAATAGGGTTAATAAATGG - Intergenic
918834068 1:189436887-189436909 CTGAAAATAAAAATAAAAAATGG - Intergenic
919047237 1:192468652-192468674 ATGTAAATAGAAACAAAAAAAGG - Intergenic
919148759 1:193668202-193668224 TTGAATATATAGATAATAAAAGG - Intergenic
919300150 1:195751802-195751824 CTGTAAATATAAATAATAATTGG + Intergenic
919310775 1:195904404-195904426 CTATAAGTAGAAATGATAAATGG + Intergenic
919347158 1:196398101-196398123 ATGTAAATAGAGTTAATTTAGGG - Intronic
919633511 1:199982116-199982138 ATAAAAATAGAGAAAATAAAGGG - Intergenic
920744150 1:208609861-208609883 CTGAAAATGGAGATAATAATAGG + Intergenic
921479311 1:215645510-215645532 CTGTAAATTTGGATAATAATAGG + Intronic
921881074 1:220254668-220254690 TTTTAAACAGAGAAAATAAAAGG + Intronic
922255462 1:223889615-223889637 CTGGAGTTAGAGATAATGAAAGG - Intergenic
922819647 1:228475343-228475365 CTGAAAATATAGAAAATCAAAGG + Intergenic
923532690 1:234823988-234824010 GTGTAAATGGAGACAATAAGAGG + Intergenic
923631824 1:235654542-235654564 CTGTAAGTGAAGATAATCAAGGG + Intergenic
924071565 1:240285512-240285534 GTGTAGATAGAGGTAAGAAAGGG + Intronic
924336666 1:242992484-242992506 CTGGAGTTAGAGATAATGAAAGG - Intergenic
924908752 1:248485944-248485966 ATGTAAAGAGAGAAAATAATAGG + Intergenic
924915356 1:248562118-248562140 ATGTAAAGAGAGAAAATAATAGG - Intergenic
1063261462 10:4393861-4393883 CTGTAAATACACTGAATAAAGGG + Intergenic
1064679141 10:17791789-17791811 CTGTGATGAGAGATAATCAAAGG - Intronic
1065224353 10:23527932-23527954 CTGGTAATAGAGCTAATAAGTGG + Intergenic
1065454664 10:25894534-25894556 CTCTAAAAAAATATAATAAAAGG + Intergenic
1066463918 10:35637151-35637173 CTGTCAATCAAGATAAGAAATGG - Intergenic
1068154675 10:53183393-53183415 TTGTTAATAGAGATACAAAATGG + Intergenic
1068719914 10:60233228-60233250 CTGAAAATAAAGAAAATTAATGG - Intronic
1069141642 10:64834843-64834865 CCATAAATAGAAATAGTAAAGGG + Intergenic
1069245154 10:66195228-66195250 TTATATATAGAGAAAATAAAGGG - Intronic
1069967558 10:72133897-72133919 TGGTAAATAGGGATAATAATTGG - Intronic
1070004367 10:72408859-72408881 TTTTAAATTGAGATAATGAACGG - Intronic
1071511775 10:86266656-86266678 CTGGCAAGAGAGATAAGAAAAGG + Intronic
1073679235 10:105684098-105684120 ATGAAATTAGAGAAAATAAAAGG - Intergenic
1073786084 10:106891272-106891294 CTGTAAATTGTGCTAATAACCGG + Intronic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1074299387 10:112219492-112219514 CTGTAAGTAATGAAAATAAAAGG - Intergenic
1074483330 10:113848636-113848658 CTGTAAATAACTATAATAAAAGG - Intronic
1075272737 10:121067514-121067536 CTGTAACAAAATATAATAAACGG + Intergenic
1075339422 10:121633457-121633479 CTGTAGATAGAGATCACACAGGG - Intergenic
1079709342 11:23662103-23662125 TTTTAAATAAAGATAACAAAAGG + Intergenic
1079711082 11:23682528-23682550 CTGTATATTGAGATGATACATGG + Intergenic
1080044548 11:27795637-27795659 CTGTAAGTGGAGAGAATAATAGG + Intergenic
1080277541 11:30519834-30519856 TTCTAAATTGAGGTAATAAAGGG + Intronic
1080357955 11:31473348-31473370 CTGTAAAATGAGATATCAAAGGG - Intronic
1081032491 11:38102275-38102297 CTTTAAGTAGAGATAATATTGGG + Intergenic
1081036598 11:38155158-38155180 CTAAAAATGGTGATAATAAAAGG + Intergenic
1081816251 11:45944764-45944786 CTCTAAAAAGAGATCAAAAATGG - Intronic
1082985747 11:59169655-59169677 CTTTCAATAGAGATTTTAAATGG - Intergenic
1083512477 11:63224187-63224209 ACGTAAAAAGAGATGATAAAGGG - Intronic
1084932211 11:72565449-72565471 CTGTGAATAGAAATAAGACAGGG - Intergenic
1085943295 11:81232798-81232820 ATGTAAATATATAGAATAAAGGG - Intergenic
1086027949 11:82317789-82317811 CTGGAAATTGAGATAAAAATGGG + Intergenic
1086139558 11:83480253-83480275 CTTTGAATACAGATGATAAAAGG + Intronic
1086203152 11:84227471-84227493 CTGTGATTAAAGAAAATAAATGG - Intronic
1086858697 11:91898868-91898890 CTCAAAATAGAGATAAAAAATGG - Intergenic
1087489411 11:98804390-98804412 CTGTAACAAGAGATAAAACATGG - Intergenic
1087491833 11:98837865-98837887 TGGTAAATAGGGATAATTAATGG - Intergenic
1087704405 11:101473252-101473274 GGTGAAATAGAGATAATAAAGGG + Intronic
1088054033 11:105553656-105553678 CTGATAATAGAGAGATTAAAAGG - Intergenic
1089959388 11:122602394-122602416 CCATAAATAAAGATAATATATGG - Intergenic
1090139479 11:124239499-124239521 CTGTAAACAGAAATAAAAGATGG + Intergenic
1090923092 11:131224474-131224496 CTTTAAATAGGGATAATACAGGG + Intergenic
1091002220 11:131919161-131919183 TTGTAAAAAAAGATAATTAATGG + Intronic
1091419595 12:324931-324953 CTGTAAAGTTATATAATAAATGG - Intronic
1092803746 12:12199411-12199433 TTTTAAACAGAGAAAATAAAAGG - Intronic
1093268859 12:17033298-17033320 CTGTAAATAAATATAATTTATGG + Intergenic
1093409463 12:18846732-18846754 CTGTAAATAAAAATATTAAATGG + Intergenic
1093540025 12:20271200-20271222 CTGTAAATAAAGAAATAAAAAGG - Intergenic
1094193566 12:27721733-27721755 CTGTAAAGACAGTTAACAAATGG + Intronic
1095205862 12:39440412-39440434 CTGTAAATGGCCATAATAACAGG + Intronic
1095682033 12:44988372-44988394 CTATGAAAAGAGATAATTAATGG - Intergenic
1095707190 12:45250094-45250116 GTGTTACTAGAGATAATAAATGG + Intronic
1096932686 12:55231423-55231445 CTGTGAACAGAGAAAATAGAAGG + Intergenic
1097376137 12:58845236-58845258 CTATCAATAGAGATAAGAAGAGG + Intergenic
1098428674 12:70394965-70394987 CTGTTAATGGAGTTTATAAATGG + Intronic
1099408381 12:82291761-82291783 TTGTAAATAGAGATAGTACCAGG + Intronic
1100894391 12:99163252-99163274 CTTTAAAAAAAGAAAATAAAAGG - Intronic
1101411908 12:104475935-104475957 TTGTAAATATATATAATATAAGG - Intronic
1102101703 12:110283172-110283194 CTGTAAATAGAACTTACAAAAGG + Intronic
1102117372 12:110413277-110413299 ATTTAAATTAAGATAATAAATGG - Intergenic
1102363974 12:112315404-112315426 CTGAAACTAGAGATAGTGAAAGG - Intronic
1103316254 12:120058154-120058176 TTGTAAATTGAGATGAGAAATGG + Intronic
1104085173 12:125467686-125467708 TTGTAATTAGAGTGAATAAATGG - Intronic
1104145428 12:126029489-126029511 CTGGAAATAGGGATGAGAAAAGG + Intergenic
1104148090 12:126054935-126054957 CTTCAAATAGAGACAATAATGGG - Intergenic
1104709184 12:130973328-130973350 CTGTAAAGTGAGTGAATAAAAGG + Intronic
1105224060 13:18410824-18410846 CTGTAAGGAGAAAAAATAAAAGG + Intergenic
1106809275 13:33343645-33343667 CTTGAAATAGAGACAATAACAGG - Intronic
1107179220 13:37438588-37438610 CTGTCAAAAGAAAGAATAAATGG - Intergenic
1107340822 13:39403607-39403629 ATCGATATAGAGATAATAAAAGG - Intronic
1109209504 13:59518373-59518395 CTATAAAAAGAAATAATCAAGGG - Intergenic
1109587984 13:64435432-64435454 TGATAAATAGAGAAAATAAAAGG - Intergenic
1109633347 13:65081841-65081863 ATGTAAATTGAGATAGTTAAGGG - Intergenic
1110192837 13:72751075-72751097 CTTTAAATGGGGATAATAATAGG + Intronic
1110193536 13:72758984-72759006 CTGTATAAAGACATACTAAAGGG - Exonic
1110211045 13:72973528-72973550 GTATAAATATAGTTAATAAATGG - Intronic
1110488068 13:76069493-76069515 CTGTAAAAAGAGACACAAAAAGG + Intergenic
1110583037 13:77154519-77154541 ATATCAAAAGAGATAATAAAAGG + Intronic
1110907084 13:80904586-80904608 CTGTAAACAAAGATGAGAAAAGG + Intergenic
1110964031 13:81668597-81668619 CTGTAAATAAAGCTAATTCAGGG - Intergenic
1111136290 13:84048990-84049012 ATGTAAATAGAGGGAAAAAAAGG - Intergenic
1111702111 13:91704246-91704268 CTGTAAAAAGAGACAAAGAAGGG - Intronic
1111722079 13:91958270-91958292 CTGTAAAAAGAAAAAAAAAAAGG + Intronic
1111736637 13:92149218-92149240 TTGTCAATAGACATGATAAAAGG - Intronic
1112188547 13:97151673-97151695 ATGAAAATAGAGAAATTAAATGG + Intergenic
1112833834 13:103488900-103488922 CTGAAAATAAAGTTAATAAATGG + Intergenic
1113159073 13:107358802-107358824 GTGTAAATAGAAAAAATACATGG - Intronic
1113499061 13:110759060-110759082 CTGTAAATTGATGTAATCAATGG + Intergenic
1114008208 14:18335646-18335668 CTGTAATGAGAAAAAATAAAAGG + Intergenic
1116377115 14:44216999-44217021 ATATAAATAGAAACAATAAAAGG + Intergenic
1116392122 14:44405438-44405460 CTGCACATAGAGATAAACAAGGG + Intergenic
1116711747 14:48377030-48377052 CTTTAGTTAGAAATAATAAATGG - Intergenic
1118506310 14:66415873-66415895 CTGTAAAAAGAGAAAATTACAGG + Intergenic
1120176415 14:81298123-81298145 CTGTAATTAGAAAGAAAAAAAGG + Intronic
1120269207 14:82289537-82289559 CCTTATATAGAGATAATAAGAGG + Intergenic
1120332164 14:83107346-83107368 CTTAAAATAGAAATAATAACTGG + Intergenic
1120383466 14:83812531-83812553 ATGTATCTGGAGATAATAAAAGG + Intergenic
1120627984 14:86853057-86853079 GAGGAAATAGAGATAAGAAAAGG + Intergenic
1120660428 14:87242288-87242310 CTGTAGATAGAATTAGTAAAAGG + Intergenic
1121037119 14:90715576-90715598 CTGTAACTGGGGATAATAATAGG - Intronic
1121865373 14:97357891-97357913 ATGTAAAGAGAAATCATAAATGG - Intergenic
1122010378 14:98741509-98741531 TTGTAAATAGAGTTTAAAAAAGG - Intergenic
1124604306 15:31159669-31159691 ATGCAAATAGAAAAAATAAAAGG - Intronic
1124833962 15:33177514-33177536 CTGTAAGTAGGGAGAACAAAAGG - Intronic
1125437612 15:39664410-39664432 CTGTAAATAAATATGATGAATGG - Intronic
1125926507 15:43567614-43567636 CGCTAAATAGAGAGAATAATAGG + Intronic
1125939651 15:43667179-43667201 CGCTAAATAGAGAGAATAATAGG + Intronic
1126256565 15:46634088-46634110 TTGTTAGTAGAAATAATAAATGG - Intergenic
1126449845 15:48794248-48794270 CTTTAAAAAGAGAAAAAAAATGG + Intronic
1126826763 15:52559142-52559164 CTGTAAAGAGATAACATAAATGG - Intronic
1127129475 15:55847458-55847480 CAGTAAATAGTAATAAAAAACGG + Intronic
1128645483 15:69375724-69375746 CTGTGAAATGAGACAATAAAAGG + Intronic
1128708437 15:69854342-69854364 CTTTAAATAGAGAGAATAGAAGG + Intergenic
1128822436 15:70671242-70671264 CTGTTTATAGAAATAATAAGGGG - Intronic
1129083010 15:73057671-73057693 TTGTAAATAGTGACAAAAAAAGG + Intronic
1129573859 15:76719620-76719642 GTGTACATATAGATAGTAAAAGG - Intronic
1131725547 15:95219383-95219405 CTATAAATAGTGTTGATAAATGG - Intergenic
1133676781 16:8080697-8080719 ATGAAAATTTAGATAATAAAGGG + Intergenic
1134227548 16:12403084-12403106 CTGAAAATGAAGATAATAACCGG - Intronic
1135126944 16:19818691-19818713 CTCTAAATATATATAAAAAACGG - Intronic
1136399051 16:30007917-30007939 CTGTAAATGGAGATAGTCAAGGG + Intronic
1137358333 16:47788378-47788400 CTGTATTTAGAAAAAATAAAAGG - Intergenic
1138163828 16:54781108-54781130 CTTCACATAGAGATTATAAAGGG - Intergenic
1138364100 16:56458518-56458540 ATGAAAATAGAGAAAAAAAAGGG - Intronic
1139799023 16:69506156-69506178 CTGGAATTACAGATAAAAAATGG + Intergenic
1140291332 16:73661139-73661161 CTGAAAATAAAGGAAATAAAGGG + Intergenic
1140552385 16:75880863-75880885 AAGTAAATAGAAATAAAAAATGG + Intergenic
1140782554 16:78309889-78309911 ATGTAAATAGGGATAATAATTGG + Intronic
1143035416 17:3992975-3992997 CTGTGAAGAAAGATAATAAAGGG + Intergenic
1143678569 17:8457686-8457708 CTACAAATAGAGGTAATAATAGG - Intronic
1144288325 17:13801109-13801131 CTGTAAATACAGGGAATCAATGG - Intergenic
1144428426 17:15168003-15168025 CTGGAAAGAAATATAATAAAAGG + Intergenic
1145091398 17:19988872-19988894 CTGTAAATAAACTGAATAAATGG + Intergenic
1146024511 17:29308108-29308130 CTGCACATGGTGATAATAAAAGG - Intergenic
1146123553 17:30215341-30215363 CTGTATATAAAAATAATAAGAGG - Intronic
1146730378 17:35188248-35188270 CTGAAAATATACACAATAAATGG + Exonic
1147451176 17:40505477-40505499 CTCAAAATAAAGAAAATAAAAGG - Intergenic
1149271398 17:54982181-54982203 CAAAAAATAGAGAAAATAAAAGG - Intronic
1149307272 17:55360248-55360270 CTGTAAAAGGAGATAAAACATGG - Intergenic
1149403018 17:56318213-56318235 ATGTAAAAATAGATAATTAATGG + Intronic
1149430968 17:56595478-56595500 TTGTAAATATAGAGAACAAATGG + Exonic
1149666260 17:58366686-58366708 CTGTAAACTGGGATAATAACAGG + Intronic
1151064749 17:71136575-71136597 CTGAAAATACAGACAATACAGGG - Intergenic
1151196655 17:72436446-72436468 ATGGAAATAGAGATAGTGAATGG - Intergenic
1151262047 17:72923841-72923863 CTATAAATAAAGAAAAAAAATGG + Intronic
1152053621 17:78002992-78003014 ATGTAAATAGTGATAAGAATAGG + Intergenic
1153513878 18:5886737-5886759 TAGTAAATGGAGATAATAAATGG - Exonic
1154529250 18:15328312-15328334 CTGTAATGAGAAAAAATAAAAGG - Intergenic
1155562019 18:27088934-27088956 CTGTAAACAGAGAGGAGAAAAGG + Intronic
1155564765 18:27121605-27121627 CTATCAATAAAGATGATAAAAGG + Intronic
1155785016 18:29884781-29884803 TTTTAAATAAAGATACTAAAGGG + Intergenic
1156064573 18:33124585-33124607 CTGAAAGTAGAGATTAAAAAGGG - Intronic
1156067328 18:33159996-33160018 CTTTGAAAAGAGATAATTAAAGG - Intronic
1157929095 18:51800763-51800785 CTGTAAAAAGAGACACAAAAAGG - Intergenic
1157938480 18:51898996-51899018 TTTTAATTAGAGTTAATAAAAGG + Intergenic
1158022108 18:52855353-52855375 CTGTGAATATAGAAAATACAGGG - Intronic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1158913184 18:62089261-62089283 CTGCAAATAGAATTAATAGAGGG - Intronic
1159178132 18:64865765-64865787 CTGTAAATATGGTTAATAAATGG - Intergenic
1159514110 18:69435361-69435383 ATGTAAATACAGATAAAATATGG + Intronic
1159550379 18:69889319-69889341 ATGTAGGTAAAGATAATAAAAGG + Intronic
1160284506 18:77528409-77528431 CTGTAAATGGAGTTAATAATAGG + Intergenic
1161570420 19:5027522-5027544 CTGAAAAGAGAGAGAAGAAAGGG - Intronic
1166962446 19:46506525-46506547 TGGGAAATAGAGATAATAATGGG - Intronic
1168214903 19:54918264-54918286 CTCTAAATAAATAAAATAAAGGG - Intergenic
925539111 2:4947372-4947394 CTAAAAATACAAATAATAAATGG - Intergenic
925849171 2:8064218-8064240 CTTTAGAAAGAGAAAATAAATGG - Intergenic
925851944 2:8090468-8090490 CTGGAAATAGAGATTATTAGAGG - Intergenic
926993999 2:18714445-18714467 CTGCTAATAAAGCTAATAAAAGG + Intergenic
928135972 2:28687747-28687769 CTGTAAATGGAGAGAAGAACTGG + Intergenic
928236489 2:29546305-29546327 CAGCAAAAAAAGATAATAAAAGG + Intronic
928346307 2:30499946-30499968 TTGTAAATCTAGAGAATAAAAGG + Intronic
928865506 2:35913048-35913070 ATGTAAATAAATATAATACAAGG + Intergenic
929395840 2:41521293-41521315 CTATAAATCAAGATAATAAAAGG + Intergenic
930145602 2:47999935-47999957 CTGGAAAAAAAAATAATAAAAGG + Intergenic
930948171 2:57102007-57102029 CTGGAAAAAGAAATAACAAATGG - Intergenic
931042317 2:58314144-58314166 CTGTGAAAAGGGATAATAATTGG - Intergenic
931666320 2:64611946-64611968 CTGTAAAATGGGATAATGAAAGG + Intergenic
933024932 2:77244532-77244554 CTGAAAATAGAGATTATGGAAGG + Intronic
933421402 2:82050487-82050509 CTCTAAGCAGAGATAATAAAGGG - Intergenic
936007132 2:108899620-108899642 CTGTAAACAGAGAAGGTAAAGGG + Intronic
937628493 2:124070583-124070605 CTGAAAATAGAGACAAAGAAGGG + Intronic
938400818 2:130989885-130989907 CTGTGAATGGAGATATTGAATGG + Intronic
938528346 2:132159718-132159740 CTGTAATGAGAAAAAATAAAAGG - Intronic
939232164 2:139442706-139442728 CTGCAGATAGACTTAATAAAAGG - Intergenic
939626341 2:144482123-144482145 CTGCAAAAAGAGAAAATGAACGG - Intronic
940645179 2:156384596-156384618 TTTTAAATAGAAATAACAAAAGG - Intergenic
940653785 2:156463824-156463846 GCATAAATAGAGAAAATAAAGGG - Intronic
940713817 2:157195240-157195262 TTGTAAATTGAGATAATCTAAGG - Intergenic
940762963 2:157758218-157758240 CTGTAAAAAGAGACCACAAAAGG + Intronic
940810866 2:158241458-158241480 CTTTAAACAGAGATGAGAAAGGG + Intronic
941465055 2:165815667-165815689 CAGCAAATAGAGATATAAAATGG + Intergenic
941705968 2:168658137-168658159 CTGTAAAATTAGATAATAATTGG + Intronic
942040949 2:172062286-172062308 CTGTAAACAAAGTTCATAAAAGG - Intronic
943122408 2:183753270-183753292 TGGGAAATAGAAATAATAAATGG - Intergenic
943831604 2:192471181-192471203 CTGTATAGAGAAAGAATAAAAGG - Intergenic
944144486 2:196492139-196492161 ATGTAAATAGAGAAAAACAAAGG + Intronic
944188244 2:196973110-196973132 TTGAAAACAGTGATAATAAATGG - Intronic
945888571 2:215404347-215404369 ATGTAAATATAGTTAAGAAAAGG + Intronic
946567262 2:220980352-220980374 CAGAAAATGGAGATAATTAAGGG + Intergenic
946753168 2:222914194-222914216 CTGTAAGTAGAGAGAAGGAAGGG + Intronic
947439448 2:230106106-230106128 CTGTAAGAAGAGACAAAAAAAGG - Intergenic
947669015 2:231925261-231925283 CTGTAAAGTGGGATAATAAAGGG + Intronic
947896251 2:233675744-233675766 CTTTAAAAAGATAGAATAAAGGG - Intronic
1169138749 20:3214242-3214264 CTGTAAGTGGAGATGGTAAAGGG + Intronic
1169184644 20:3603919-3603941 CTATAAATGAAGATAATAATAGG + Intronic
1169981467 20:11389480-11389502 CTTTAAATAGAGACAATGATGGG + Intergenic
1170953363 20:20956306-20956328 GGGTAAATAGATAAAATAAATGG + Intergenic
1171183127 20:23105535-23105557 CTGTAAATTGAGATGATCACAGG - Intergenic
1171776938 20:29377583-29377605 CTATAAATAGAGCTACTATATGG - Intergenic
1172439363 20:34954911-34954933 CTGGAAATGGAGATAAATAAAGG - Intronic
1173065951 20:39711730-39711752 GGGTAAATGGAGATAATTAATGG - Intergenic
1173463988 20:43266873-43266895 CTTTAAATAGAAAGAAAAAATGG + Intergenic
1173594577 20:44250342-44250364 CTGTAAATTGAGAATATTAATGG + Intronic
1174967908 20:55240100-55240122 CAGGCAATAGAGATGATAAAAGG - Intergenic
1175105366 20:56611106-56611128 CTGTAAATAGAAATATGCAAAGG + Intergenic
1175139744 20:56852017-56852039 ATGTAAATAGTGAAACTAAAAGG - Intergenic
1175242370 20:57559156-57559178 CTGTAAATGCAGGTAATGAAAGG + Intergenic
1176359210 21:5980357-5980379 CTGTAAAAAGAGACAAAAGAAGG - Intergenic
1176768150 21:13040186-13040208 CTGTAAGGAGAAAAAATAAAAGG + Intergenic
1176928302 21:14777919-14777941 CTGTAAATAGACATATTTACTGG - Intergenic
1177399583 21:20585263-20585285 AAGCAAATAGAGAAAATAAATGG + Intergenic
1178183722 21:30194822-30194844 TTGTAAATAGAGAAGATGAAAGG - Intergenic
1178225430 21:30711623-30711645 TTGAAAATAGAGAGAATAAAGGG + Intergenic
1178999569 21:37444153-37444175 ATGTAAATATTTATAATAAAAGG - Intronic
1179764308 21:43558193-43558215 CTGTAAAAAGAGACAAAAGAAGG + Intronic
1180432713 22:15266463-15266485 CTGTAATGAGAAAAAATAAAAGG + Intergenic
1180764284 22:18234556-18234578 CTGTAAGTGGGGATAATAATAGG + Intergenic
1180771357 22:18389985-18390007 CTGTAAGTGGGGATAATAATAGG - Intergenic
1180802741 22:18639600-18639622 CTGTAAGTGGGGATAATAATAGG - Intergenic
1180853979 22:19035156-19035178 CTGTAAGTGGGGATAATAATAGG - Intergenic
1181218979 22:21355661-21355683 CTGTAAGTGGGGATAATAATAGG + Intergenic
1181657398 22:24314692-24314714 CAATAAATACAGACAATAAAGGG - Intronic
1182406943 22:30142611-30142633 TTGTAACTGGAGATAATAAGGGG - Intronic
1184919847 22:47598188-47598210 CTGGAAATGGATACAATAAAAGG - Intergenic
1203233197 22_KI270731v1_random:130976-130998 CTGTAAGTGGGGATAATAATAGG - Intergenic
949095206 3:77451-77473 CTGTTAATAGAGGAAATAAAAGG + Intergenic
949294448 3:2504864-2504886 ATGTAATAAGAGACAATAAAAGG + Intronic
949295291 3:2514588-2514610 CTGTTACTAGAGATAACCAATGG - Intronic
949600203 3:5590082-5590104 ATGAAAATGGAGATTATAAAAGG - Intergenic
949688478 3:6606734-6606756 CAGAACACAGAGATAATAAAAGG - Intergenic
950924050 3:16722465-16722487 CTTTAATTAGAGATAAACAATGG - Intergenic
951772044 3:26269295-26269317 ATATAAATAGGGATAATAATAGG - Intergenic
951901575 3:27662799-27662821 CTGTAAAAAGGGATATTAATAGG + Intergenic
951927704 3:27926523-27926545 TGGTAAATAGTGATAATAATAGG - Intergenic
953048243 3:39315103-39315125 ATTTAAAGAGAGATAATAAAGGG + Intergenic
953700342 3:45190784-45190806 CTTTAAAGAGAGAAAATAACAGG - Intergenic
955251869 3:57291028-57291050 CTCTAAGTAGGGATAATAATAGG + Intronic
955712503 3:61795108-61795130 CTGTAAAATGGGATACTAAAAGG - Intronic
956253612 3:67260929-67260951 CTATGAACAGAGATAAGAAATGG - Intergenic
956518375 3:70076509-70076531 CTGTAAATATGCATAAAAAAGGG + Intergenic
956937514 3:74120214-74120236 ATGTTATTAGAGTTAATAAAAGG - Intergenic
957005283 3:74938450-74938472 AGCTAAACAGAGATAATAAACGG + Intergenic
957033045 3:75265261-75265283 GGGTAAGTATAGATAATAAAGGG + Intergenic
957275113 3:78081094-78081116 CTTTAAACCGATATAATAAAGGG + Intergenic
957437940 3:80203199-80203221 CTGTAATAAGAAATAATAAGAGG - Intergenic
957597999 3:82292516-82292538 CTATAAATAGGGACAAGAAAAGG - Intergenic
957739904 3:84251124-84251146 CTTTAAATGGTGATAATAATGGG + Intergenic
957812985 3:85252451-85252473 TTGTAAGTAGAGATTTTAAAAGG + Intronic
958655634 3:96999273-96999295 CTTTAAATAGAGAAAATTTAAGG + Intronic
958910636 3:99990357-99990379 CTGTGAATAGAGAGATTGAACGG - Intronic
960209234 3:114939404-114939426 TTGAAAATAGAGATAAAATATGG + Intronic
960526862 3:118719727-118719749 CTATAAATAGGGAGAGTAAAGGG - Intergenic
960984717 3:123269263-123269285 CAATAAATATAGATAAAAAATGG + Intronic
962045121 3:131750578-131750600 TTATAAACAGGGATAATAAAAGG - Intronic
962159554 3:132984535-132984557 CTGTAATTAATGCTAATAAAGGG + Intergenic
963846973 3:150169198-150169220 CTGTAAATGGAGAAAATAGTAGG - Intergenic
964245092 3:154642426-154642448 CTGTAAAGAGAGATAAGGCAAGG - Intergenic
964246340 3:154658364-154658386 CTGTATAAAGGGAAAATAAAAGG - Intergenic
964503404 3:157373100-157373122 CTGTAAATGGAGTTACTAATAGG - Intronic
965172505 3:165284749-165284771 CTTTATTTAGAGATTATAAAAGG - Intergenic
966755461 3:183366930-183366952 CTGTAAATAGGGAAAAAAGAAGG + Intronic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
969390217 4:6887152-6887174 ATGTAAATGGAGATCATAACTGG + Intergenic
969640099 4:8392596-8392618 TTGTAATTAGAAATAAAAAAGGG + Intronic
970636654 4:18018405-18018427 ATGTAAGTAGAGATATTAATTGG + Intronic
971158010 4:24103857-24103879 TTGGAAATAAAGATAATGAATGG - Intergenic
971676020 4:29630627-29630649 TGGTAAATTAAGATAATAAAAGG - Intergenic
973186221 4:47332324-47332346 CTATAATTATGGATAATAAATGG - Intronic
973738492 4:53896366-53896388 CTGTAAATAGGGATAACAGTAGG - Intronic
974192177 4:58519681-58519703 CTGTACATAGTGATAAGTAAGGG + Intergenic
974306436 4:60148333-60148355 ATGTATTTAGAGAAAATAAAAGG + Intergenic
975215512 4:71749436-71749458 CTGTATAGACAGATAACAAAGGG + Intronic
976152585 4:82107110-82107132 CTGTAAAATGAGGTAATAACAGG - Intergenic
976863671 4:89697848-89697870 ATGTACAGAAAGATAATAAAAGG + Intergenic
977138259 4:93334025-93334047 CTGGAATAAGAGATAATCAAAGG + Intronic
978248888 4:106606800-106606822 TTTTAAAAAGTGATAATAAAAGG - Intergenic
978878018 4:113665554-113665576 CAGTAAAGACAGATTATAAAAGG + Intronic
979240462 4:118442825-118442847 CTGGAGTTAGAGATAATGAAAGG + Intergenic
979409589 4:120360374-120360396 CTATTAATTGAGAAAATAAAGGG + Intergenic
979560051 4:122091361-122091383 CTGTTCATTGAGATAATCAACGG - Intergenic
979631813 4:122910929-122910951 ATGAAAAGAGAGATAATTAAAGG + Intronic
979852452 4:125590617-125590639 GACTAAATAGAAATAATAAAGGG + Intergenic
980303676 4:131027459-131027481 ATTTAAAAAGGGATAATAAAGGG - Intergenic
980828241 4:138097717-138097739 CTGTGAACAGTGATAATGAACGG + Intergenic
981425372 4:144596713-144596735 CTGTAATTAGTTATAATAATAGG + Intergenic
981431520 4:144666869-144666891 TGTTAAATAGAGACAATAAAAGG + Intronic
982160737 4:152566854-152566876 CTGGAAATGAAGAAAATAAAAGG + Intergenic
983096047 4:163563273-163563295 ATCTAAATAGAGGTAATAATAGG - Intronic
983948756 4:173615787-173615809 TTTTAAACAGAGAAAATAAAAGG - Intergenic
984091464 4:175380456-175380478 ATGTAAATAGAGAAAATATTAGG + Intergenic
984686769 4:182678209-182678231 TTGTAACTAGAAATAATACAGGG - Intronic
985919124 5:2954658-2954680 CTGTAAAAAGAGACAAAGAAGGG - Intergenic
986008707 5:3692052-3692074 TTGTAATCAGAGAAAATAAAAGG + Intergenic
986534227 5:8769934-8769956 TTGTGAACAGAGATAATAATTGG + Intergenic
986607521 5:9536744-9536766 CTGTAAATAGAAAAGAAAAATGG - Intronic
987135343 5:14894723-14894745 ATGCAAAGAGAGACAATAAAAGG + Intergenic
987746144 5:21974618-21974640 CTGTAAATAGAGATTCTGGAAGG - Intronic
987777346 5:22385235-22385257 CTGTATGTAGAAATAAAAAAAGG - Intronic
988747492 5:34155546-34155568 CTGTCAATAGAGTTCTTAAAAGG - Intergenic
988938755 5:36119272-36119294 CTGGAGATATTGATAATAAAAGG - Intronic
988950476 5:36253510-36253532 CTATAAACAGACATAATGAATGG + Intronic
988981656 5:36575544-36575566 CTGTGAATAGTGTTAATATATGG - Intergenic
989994296 5:50809260-50809282 CTGTAAATACAGAGAATTAAAGG + Intronic
990072092 5:51795458-51795480 CTTAAATTAGAGATAAAAAAAGG - Intergenic
990255184 5:53961026-53961048 ATGTAGATAGAGAAACTAAAGGG - Intronic
990432345 5:55748313-55748335 ATGTAAATAGACATGTTAAAAGG - Intronic
991166648 5:63570690-63570712 CTGTAAGTAGTGGGAATAAAAGG + Intergenic
991225107 5:64261261-64261283 CAGGAAAAAGAGATTATAAATGG + Intronic
991578455 5:68129173-68129195 GTGTAATTAGTGATGATAAATGG - Intergenic
991766350 5:69984728-69984750 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991780968 5:70133425-70133447 CTGTAAATAGAGATTCTGGAAGG + Intergenic
991845583 5:70859811-70859833 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991873414 5:71133739-71133761 CTGTAAATAGAGATTCTGGAAGG + Intergenic
992221058 5:74574230-74574252 ATTTAAAAAGAAATAATAAAAGG - Intergenic
993440747 5:87954141-87954163 CTGTAAAAGGATAAAATAAAGGG - Intergenic
993646033 5:90463720-90463742 GTGTTAATAGAAATAATAAAGGG + Intronic
993677321 5:90832365-90832387 TGGTAAATAGGGATAAGAAAAGG - Intronic
993860060 5:93125249-93125271 CTGAAAATAGATTTAAGAAAAGG + Intergenic
994032798 5:95164753-95164775 TTATAAATAGAAATATTAAAAGG - Intronic
994069455 5:95583424-95583446 CTATAAACAGAGAAACTAAAAGG + Intronic
994468335 5:100168681-100168703 ATTTAAATACAAATAATAAAAGG - Intergenic
994728850 5:103468502-103468524 TTTTAAATACAAATAATAAATGG - Intergenic
995044408 5:107628933-107628955 CTGCAAATACAGAAAATAAATGG + Intronic
995249530 5:109975212-109975234 GTGTATATATAGATAGTAAATGG - Intergenic
996173814 5:120330857-120330879 CTGAAAATAGTGATGATACATGG + Intergenic
998908880 5:146936613-146936635 CTGTACAGAGAGATAGTAAGAGG + Intronic
999503466 5:152170250-152170272 GTGAAGATAGAGATAGTAAATGG + Intergenic
999601915 5:153276239-153276261 GTATAAATAGAGACAAGAAAAGG - Intergenic
999655328 5:153805259-153805281 ATGTAAATAGGGATAATAAAAGG - Intronic
1000224154 5:159242559-159242581 CTGCAACTACACATAATAAATGG + Intergenic
1000870539 5:166571729-166571751 CTGTAAATAAAGGTACAAAAGGG + Intergenic
1002665702 5:180822745-180822767 CTGAATATATAGAGAATAAATGG - Intergenic
1002740717 5:181433404-181433426 CTGGAGTTAGAGATAATGAAAGG + Intergenic
1003832917 6:10034545-10034567 CTGTTAATAGACATAATAGCTGG - Intronic
1004569103 6:16827734-16827756 ATGTAAATGGAGTTAATGAAAGG - Intergenic
1004825068 6:19411074-19411096 CTGTATGTATAGATAACAAAAGG + Intergenic
1005236840 6:23773571-23773593 CTTTCAGTAGAGATAACAAAGGG - Intergenic
1005411765 6:25556519-25556541 CTCCAAAGAAAGATAATAAAAGG + Intronic
1005544987 6:26857870-26857892 CTGTCAATAGAGTTCTTAAAAGG - Intergenic
1005617555 6:27589276-27589298 CTCTAAACAGAGTTAACAAATGG + Intergenic
1005696042 6:28353751-28353773 CTGTGGATAGAGAAAAGAAAAGG + Intronic
1007085002 6:39137343-39137365 ATGTTAAAAGAGATAATACACGG - Intergenic
1007142996 6:39595242-39595264 GTGTAAATAGAGGTTACAAATGG - Intronic
1008255669 6:49296892-49296914 CTGTAAATAAAGCAATTAAAAGG + Intergenic
1008460740 6:51767262-51767284 ATGTAACTAAATATAATAAAAGG - Intronic
1009015777 6:57899491-57899513 CTGTCAATAGAGTTCTTAAAAGG - Intergenic
1009661391 6:66616135-66616157 ATGTAAATAAAGTTTATAAAAGG - Intergenic
1010072159 6:71756115-71756137 TGGTAAATAGAGGTAGTAAATGG + Intergenic
1010627458 6:78155864-78155886 TGGTAAATTGAGATAATGAAAGG + Intergenic
1010809383 6:80281679-80281701 CTGCAAATTGAGGAAATAAATGG - Intronic
1011868325 6:91860463-91860485 CTATAAATACAGTTAATGAATGG - Intergenic
1013165844 6:107591212-107591234 TTGTAAAATGTGATAATAAAAGG + Intronic
1014164853 6:118212324-118212346 CTGTAATTAGAAAAAGTAAATGG - Intronic
1015269184 6:131322178-131322200 CTGGAGCTAGAAATAATAAATGG - Intergenic
1015552554 6:134427226-134427248 CTTTAAATAGTGTTAAAAAATGG - Intergenic
1016225626 6:141732457-141732479 CTGGAAATTGAGAAAAGAAAAGG - Intergenic
1016580367 6:145622866-145622888 CTGTGAACAGAGATTATAATGGG + Intronic
1016738115 6:147502185-147502207 TTAAAAATAGAGAAAATAAAAGG - Intergenic
1018620194 6:165723338-165723360 CAGTCAACAGAGAAAATAAAGGG - Intronic
1019245826 6:170709000-170709022 CTGGAGTTAGAGATAATGAAAGG + Intergenic
1019835223 7:3376873-3376895 CTGGAAAGAGAGACAATAGAAGG - Intronic
1019841159 7:3446251-3446273 CACAAAATAGAGATAATAGAGGG - Intronic
1020480898 7:8659211-8659233 AACTAAATGGAGATAATAAACGG + Intronic
1020708558 7:11576235-11576257 CTATAAATACCGACAATAAAGGG - Intronic
1021376616 7:19915827-19915849 CTGTAAAGGGTGATAATAAAAGG - Intergenic
1021570919 7:22064492-22064514 CTATAAATTGATATAATAATAGG - Intergenic
1021775226 7:24047889-24047911 CTGCAATCAGAGATAATGAATGG - Intergenic
1022052417 7:26690363-26690385 CTGTAAATAAACATTATCAATGG + Intronic
1022063509 7:26825871-26825893 ATGTGTATAGAGAGAATAAAAGG - Intronic
1022287584 7:28968962-28968984 CTAGAAATACATATAATAAAAGG - Intergenic
1022707650 7:32819623-32819645 CTGTAAATTGGGGTAATAAATGG + Intergenic
1022915266 7:34943384-34943406 CTGTAAATTGGGGTAATAAATGG - Intronic
1023139704 7:37089765-37089787 CTGTAAAGAGACAGAATTAAGGG + Intronic
1023169614 7:37377974-37377996 CTGTCAATAGACAGACTAAAAGG - Intronic
1023741712 7:43287165-43287187 CTGTAAAGAGAAATAATACAGGG + Intronic
1023890148 7:44386129-44386151 CAGAAAATAGAGAGATTAAAGGG + Intronic
1027130483 7:75586939-75586961 CTCTAAATAAATAAAATAAAGGG - Intronic
1027293633 7:76743517-76743539 CTGAAAATAGAGATAGTAGGTGG + Intergenic
1027599393 7:80220714-80220736 CAGTAACTAGAGATCAAAAAAGG + Intergenic
1027814125 7:82947100-82947122 TTGTAACTAGAGGGAATAAATGG - Intronic
1028053255 7:86209932-86209954 ATGTAAATAGTTTTAATAAAGGG - Intergenic
1028441245 7:90864217-90864239 ATGTAAATAGACAAGATAAACGG - Intronic
1028980654 7:96964542-96964564 CCTGAAATAGAGAAAATAAAGGG - Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029953486 7:104612360-104612382 CAGTAAATGGAGATAATGAATGG + Intronic
1030414372 7:109222564-109222586 CTGTATTTATAGATAGTAAAAGG + Intergenic
1030707572 7:112710232-112710254 CTGTAAGCAGAGGTAATAAAAGG + Intergenic
1030724466 7:112909347-112909369 GTGTAAATGAAGAAAATAAAAGG + Intronic
1031217054 7:118908180-118908202 CTGTGAATAAAAATAATAAGAGG - Intergenic
1031231818 7:119116584-119116606 CTGTAAATAAAAGTAAAAAATGG - Intergenic
1031832021 7:126639353-126639375 CTGGAAATAAATTTAATAAATGG - Intronic
1032093720 7:128926830-128926852 ATGTAAATAGATTTAATAAGAGG - Intergenic
1032765240 7:134985670-134985692 GTAGAAATGGAGATAATAAATGG - Intergenic
1034051137 7:147985518-147985540 CTGAAAGCAGAGATAAAAAAAGG + Intronic
1034170264 7:149057491-149057513 CTTCAAATAAAGATAATAATAGG - Intergenic
1035502297 8:99198-99220 CTGGAGTTAGAGATAATGAAAGG - Intergenic
1036040205 8:5070002-5070024 CTGTAAATAGAGGTGGTACAGGG + Intergenic
1037103936 8:15081666-15081688 TTGTAATTAGTGATAATGAAGGG + Intronic
1037389362 8:18377304-18377326 TTGTAAAAAGAGACAAAAAAAGG + Intergenic
1037411913 8:18606919-18606941 TTGTAAATATAGTTAATAATGGG - Intronic
1038112946 8:24520103-24520125 CACTAAGTAGAGATGATAAAGGG - Intronic
1038116814 8:24565472-24565494 TTAAACATAGAGATAATAAATGG - Intergenic
1038825793 8:31000192-31000214 CTCTAAATAGAAACACTAAATGG + Intronic
1038885068 8:31654320-31654342 AGGTGAATAGAGATAATGAATGG + Intronic
1038924136 8:32118935-32118957 CTGAGAAAAGAGAAAATAAAGGG + Intronic
1039301543 8:36214640-36214662 CTGAAACTTGAGATAATGAATGG - Intergenic
1039366148 8:36929985-36930007 TTGAAAGTAGAGAAAATAAATGG + Intronic
1040687878 8:49897639-49897661 CTCTTAAAAGAGATATTAAATGG + Intergenic
1041335681 8:56779948-56779970 GGGTAAATAGATATTATAAAAGG + Intergenic
1041756455 8:61318558-61318580 ATGAAGATAGAAATAATAAAAGG - Intronic
1042062641 8:64837543-64837565 TTGTATATAGAGATAGGAAAAGG + Intergenic
1043219255 8:77637872-77637894 TAATCAATAGAGATAATAAAGGG + Intergenic
1043495302 8:80793653-80793675 TTGTAAATATAGATAAAGAAAGG - Intronic
1043699006 8:83259944-83259966 CTGTATTTATAGACAATAAAAGG + Intergenic
1043909746 8:85848934-85848956 CTGAAACTAGAGAAATTAAATGG + Intergenic
1043925226 8:86029381-86029403 CTTTAAATAGAAATTTTAAAAGG - Intronic
1044465820 8:92503733-92503755 CTGTAAATAGGAACAATAAAAGG - Intergenic
1045042900 8:98244015-98244037 CTTTAAGAAGTGATAATAAAGGG - Intronic
1045148851 8:99379667-99379689 ATGTGAATAGTGTTAATAAATGG - Intronic
1046092062 8:109514355-109514377 CAAAAAATAGAAATAATAAAAGG - Intronic
1046123244 8:109871013-109871035 CTGTAAATTGGGCTAATTAATGG + Intergenic
1046135092 8:110015801-110015823 CTGTAAAAAGAAACAAAAAAAGG - Intergenic
1046581235 8:116095021-116095043 TAGTAAAGAGAGATAATATAAGG - Intergenic
1047109867 8:121777588-121777610 CAGCAAATAAAAATAATAAAAGG - Intergenic
1047142561 8:122157814-122157836 CAGTACATAATGATAATAAATGG + Intergenic
1047337999 8:123954621-123954643 GTGTGAAATGAGATAATAAATGG - Intronic
1047786644 8:128159809-128159831 CTGGAAGAAGAGATTATAAAGGG - Intergenic
1047857077 8:128922416-128922438 TTGTAAATAGAAGTAATAAATGG - Intergenic
1047933875 8:129756244-129756266 CTGTAAGGAGAGACAAAAAAAGG + Intronic
1048944792 8:139434411-139434433 ATGCAAAGAGAGATAATAAAGGG + Intergenic
1050842763 9:10173080-10173102 TTCCAAATAGAGATAAAAAATGG - Intronic
1051605181 9:18911454-18911476 ATGTAAATGGAGATAATCATAGG - Intergenic
1051710642 9:19927373-19927395 CAAAAAATGGAGATAATAAATGG + Intergenic
1051857710 9:21588439-21588461 CTGTAAATACAGAAAATAATAGG - Intergenic
1051877193 9:21805190-21805212 CTTAAAATAGAGATATTAACGGG + Intronic
1052683134 9:31720148-31720170 CTGTAAATAGAAAGAGGAAAAGG + Intergenic
1052812577 9:33074681-33074703 CAGATAATAGAGATAATAAGTGG + Intronic
1053706964 9:40766055-40766077 CTGTAATGAGAAAAAATAAAAGG - Intergenic
1054416879 9:64886823-64886845 CTGTAATGAGAAAAAATAAAAGG - Intergenic
1054742488 9:68821996-68822018 ATGAAAATACACATAATAAAAGG + Intronic
1055202406 9:73682695-73682717 ATGTAAATTGAGATAACCAAAGG - Intergenic
1055968008 9:81884071-81884093 TTTTATGTAGAGATAATAAATGG - Intergenic
1057537517 9:95927556-95927578 CTGTAAATAGAGAAACAAAGGGG + Intronic
1058223558 9:102332528-102332550 GTGTTTATAGAGATAATAACAGG - Intergenic
1059905482 9:118980143-118980165 CTTTCAATAAAAATAATAAAAGG - Intergenic
1060632380 9:125171181-125171203 CTATAAAAAGAGAAAATAAAAGG + Intronic
1203606025 Un_KI270748v1:58211-58233 CTGGAGTTAGAGATAATGAAAGG + Intergenic
1187310683 X:18138256-18138278 CTGTAAAATGGGATAATAATAGG + Intergenic
1187311286 X:18145798-18145820 GTGAAAATAGAGATTGTAAATGG - Intergenic
1187572158 X:20515744-20515766 CTGTAAATACATATAATTCATGG - Intergenic
1187934593 X:24323149-24323171 AGGTAAATAGAGATAACAGAAGG - Intergenic
1188118742 X:26278709-26278731 CTGTAAGTGGAGAGAATAAGAGG - Intergenic
1188827767 X:34857523-34857545 GTGTAAATAGAGAAAGTAATTGG - Intergenic
1188891535 X:35616984-35617006 CTCTAAGAAGAGAAAATAAAAGG + Intergenic
1189118351 X:38367268-38367290 CTGTAAAAAGAGATTTAAAAGGG - Intronic
1189550739 X:42090012-42090034 CTGTGAATAAAGGTAAAAAAAGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190814221 X:53914769-53914791 CTATAAATGGAAAAAATAAAAGG + Intergenic
1191097641 X:56690460-56690482 CTAAAAATAAAGATAATAAAAGG - Intergenic
1191822491 X:65327837-65327859 TTTTAAACAGAGAAAATAAAAGG - Intergenic
1191926803 X:66320856-66320878 CTTAAAAGAGAGATAATAACTGG + Intergenic
1192046414 X:67678892-67678914 AGGAAAAGAGAGATAATAAAAGG + Intronic
1193546526 X:82837318-82837340 TTGTAAATATAGGTAATATAGGG + Intergenic
1193574443 X:83182041-83182063 CTGGAAAGAGAGAGAAAAAAGGG - Intergenic
1195369688 X:104161032-104161054 ATGTAAATAAAAATAATAAAAGG - Intergenic
1195623638 X:106984859-106984881 CTCTAAAAAGAGTTATTAAAAGG + Intronic
1196377750 X:115053341-115053363 CTTTAAATGGGGATAATAATAGG + Intergenic
1197240439 X:124117590-124117612 CTGAAAAAGGAAATAATAAATGG - Intronic
1197803888 X:130380867-130380889 CTGTTCATGGAAATAATAAATGG + Intergenic
1197930499 X:131690104-131690126 CTGCCCTTAGAGATAATAAATGG + Intergenic
1198118988 X:133572610-133572632 CTAAAAACAGAGATAAAAAAGGG + Intronic
1198418694 X:136447199-136447221 CTGTTAATGGAGCAAATAAAGGG + Intergenic
1198627202 X:138590354-138590376 CACTAAATAGAGAACATAAATGG - Intergenic
1199340082 X:146667377-146667399 ATGTAAATAGATATAATTCAGGG + Intergenic
1199348395 X:146769531-146769553 CTGAAAATATGGATAATAATTGG - Intergenic
1199392759 X:147300027-147300049 CTTTAAATAAAGATGATCAAGGG - Intergenic
1199399428 X:147379637-147379659 CTGTTTATGGAGAAAATAAAAGG + Intergenic
1201459031 Y:14201915-14201937 CTGGAAATAGAGGTTATACAAGG - Intergenic
1201986084 Y:19967553-19967575 CTATAAATTGAAAAAATAAATGG + Intergenic
1202164799 Y:21976043-21976065 GGGCAAATAAAGATAATAAATGG + Intergenic
1202226557 Y:22610331-22610353 GGGCAAATAAAGATAATAAATGG - Intergenic