ID: 908731250

View in Genome Browser
Species Human (GRCh38)
Location 1:67228822-67228844
Sequence TCTTATAAGCAGAAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908731250_908731254 16 Left 908731250 1:67228822-67228844 CCTTCTCCCTTCTGCTTATAAGA 0: 1
1: 0
2: 4
3: 62
4: 406
Right 908731254 1:67228861-67228883 CAGATCCACCCATGTAATCTAGG 0: 1
1: 0
2: 2
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908731250 Original CRISPR TCTTATAAGCAGAAGGGAGA AGG (reversed) Intronic
900323144 1:2094886-2094908 TTTTATAGGCAGGAGAGAGAGGG - Intronic
903018951 1:20380140-20380162 GCTAATAAGCAGCAGGGTGAGGG - Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903911517 1:26729849-26729871 TCTTATACACAGCAGGTAGATGG + Exonic
904601229 1:31673669-31673691 TCTTATAAGCATTGTGGAGATGG + Intronic
905934622 1:41813612-41813634 TCTTCTACGCCAAAGGGAGAAGG + Intronic
908355336 1:63322034-63322056 TCTAATTAGCAGGAGGGAGCCGG + Intergenic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909122229 1:71617807-71617829 TCTTATACACAGAAGTGAGATGG + Intronic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
909771224 1:79424689-79424711 TCTTATAAGAAGGAGCCAGAAGG - Intergenic
912668713 1:111606378-111606400 TTTTATAAGAAGAAGGTAGCTGG + Intronic
914324176 1:146595336-146595358 TGTTATAGGAAGAAGTGAGAGGG - Intergenic
914972391 1:152320352-152320374 TCTTATAAGCAGAATACAGTTGG - Intronic
915075249 1:153302847-153302869 GCGTATAAGCAGAAGGGAAAGGG + Intronic
915160835 1:153919399-153919421 TCATATATCCACAAGGGAGAAGG + Intronic
915607161 1:156959822-156959844 GATTAGAAGGAGAAGGGAGACGG + Intronic
916863007 1:168826361-168826383 TCCAATAGGCAGATGGGAGAAGG - Intergenic
917528112 1:175807662-175807684 TATTATAAGCAAAAAGGACATGG - Intergenic
917621019 1:176795959-176795981 TGTTTTAAAGAGAAGGGAGAAGG + Intronic
917757723 1:178119299-178119321 TCTTACACACAGAAGTGAGATGG - Intronic
918750998 1:188269233-188269255 TCTTATACACAGATGTGAGATGG - Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919091258 1:192980909-192980931 TCTTATACCCAGAAGTGAGATGG + Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
919626724 1:199918219-199918241 TCTTATAAGCAGAACTGACTTGG + Intergenic
920030883 1:203036697-203036719 TGTTATCAGCATCAGGGAGATGG + Intronic
921952326 1:220943338-220943360 TCATATAAACAGATGGGAAAAGG + Intergenic
922054049 1:222023336-222023358 TCTTCCAAGCAGAAGGGCGATGG + Intergenic
922135713 1:222824063-222824085 TCTTATAACAAGTTGGGAGATGG - Intergenic
922477735 1:225918427-225918449 TCTTCTCAGCAGGAGGGTGAAGG + Intronic
923029928 1:230240969-230240991 TCTTAGTAGCAAAATGGAGATGG - Intronic
923791251 1:237113018-237113040 TCTTGGATGCAGAAAGGAGAAGG - Intronic
1063097084 10:2917785-2917807 TCTGATATGGAGGAGGGAGAGGG - Intergenic
1063783901 10:9358098-9358120 TCATAGAAGTAGAAGAGAGATGG - Intergenic
1064130106 10:12701933-12701955 TCTAGTCAGCAGAAGGGAAAAGG + Intronic
1064301443 10:14126602-14126624 TATTCTATGCAGATGGGAGAAGG - Intronic
1064654508 10:17543828-17543850 TGGTATATGCTGAAGGGAGAGGG - Intergenic
1065111837 10:22448050-22448072 TCTTAAAAAAAGAAGGGAGTGGG - Intronic
1065376250 10:25045666-25045688 TATTATAAGCAGAAGAGAAGTGG - Intronic
1065694969 10:28371351-28371373 TCTTATAAGAGGGAGGCAGAGGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1067709149 10:48634873-48634895 TCTTATAAGCAGAGGAGATAAGG + Intronic
1068979393 10:63045588-63045610 TCTTATAAGCAGCATGTAGTGGG - Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1070354799 10:75629363-75629385 TCTTAAATCCAGAAAGGAGAAGG - Intronic
1070613408 10:77950128-77950150 TCTGCTAAGGGGAAGGGAGAGGG - Intergenic
1071827890 10:89343387-89343409 TCTTCAAATGAGAAGGGAGAAGG + Intronic
1073474219 10:103742376-103742398 TCTTATAAGAGAAAGGCAGAAGG - Intronic
1073964551 10:108973845-108973867 TCTTTTAATTAGAAGGGAGCAGG - Intergenic
1074290446 10:112134223-112134245 GCTGAAAAACAGAAGGGAGAGGG + Intergenic
1074628255 10:115218922-115218944 TCTTATACACAGAAGTGAGGTGG - Intronic
1075086897 10:119419707-119419729 CCTTCTCAGCAGATGGGAGAAGG - Intronic
1075660769 10:124194022-124194044 TCTTTTGAGCAGAAGGAAGAAGG + Intergenic
1075912333 10:126135413-126135435 TCTTGTAAGCAGTGGAGAGAGGG + Intronic
1076113394 10:127878536-127878558 TCTTTTAAGCACTAGGGAGAAGG + Intronic
1076463332 10:130661178-130661200 TCTTCAAAACAGAAAGGAGAGGG + Intergenic
1077746429 11:4911941-4911963 GCTTATAAGCAGAAGTTAGTTGG - Intronic
1078479999 11:11667433-11667455 TCTTACAAGAGGAAGGCAGAGGG - Intergenic
1078869127 11:15327792-15327814 TCTTAGAGGGAGAAGGGGGATGG + Intergenic
1079000511 11:16751065-16751087 TCTTATACACAGAAGAGAGACGG + Intronic
1079153080 11:17919254-17919276 GGTTATAAGCAGGAGAGAGAAGG + Intronic
1079570064 11:21932039-21932061 TCGTATACGCAGAAGTGAGATGG + Intergenic
1081311414 11:41578554-41578576 TCTTCTCAGCAAAAGGGAGGAGG - Intergenic
1081554180 11:44142829-44142851 TATTCTAAGCTGAAGGGAGCAGG - Intronic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1083178831 11:60971472-60971494 TCTTCTAAGAAGAAGGGAAGTGG - Intergenic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1085773850 11:79348078-79348100 TCTTATCAAAAGAAGTGAGAGGG - Intronic
1086232185 11:84583282-84583304 TTTTAAAAGCAACAGGGAGAGGG - Intronic
1086295195 11:85358809-85358831 TCTTATAAAGAGAAGGGTAATGG - Intronic
1086728519 11:90219884-90219906 TCTTTTAAGCAGATTGCAGAGGG - Intronic
1087370647 11:97279642-97279664 TCTCCTAAGCATAAGGAAGAAGG - Intergenic
1088131268 11:106494581-106494603 TCTTATAAGCAAAAGAGTTATGG + Intergenic
1088141805 11:106625826-106625848 TCTTATAAGAGGAAGGCAGGAGG - Intergenic
1088667596 11:112108952-112108974 TCTTATACACAGAAGTGAGATGG - Intronic
1088700223 11:112404850-112404872 TCTGATAGGCAAAAGGGAGCAGG + Intergenic
1089355622 11:117850457-117850479 TCTTATAAACAGCAAAGAGATGG + Intronic
1090045762 11:123331604-123331626 TGTTATAGACAGAAGGGAGAAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090608886 11:128452489-128452511 TCTAATAAGCTGAAGAGAAAAGG - Intergenic
1091328912 11:134715038-134715060 TCAGATCAGCAGAATGGAGAGGG + Intergenic
1091646907 12:2280035-2280057 TCTCATAAGCAGCAGATAGATGG + Intronic
1092006427 12:5074197-5074219 TCTTGGAAGCACATGGGAGATGG - Intergenic
1092494002 12:8973442-8973464 TCATATGGGCAGAAGGCAGAAGG - Intronic
1092603872 12:10098108-10098130 TGATATAATCAGAAGGGAAAGGG + Intronic
1093823260 12:23648542-23648564 TCTTATAAGCAGAACAGATTAGG + Intronic
1094083288 12:26561105-26561127 CCTTATAAGAAGAAGGGATTAGG + Intronic
1094145674 12:27226149-27226171 GCGTATAGGAAGAAGGGAGAAGG + Intergenic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1097399652 12:59113677-59113699 TCTTATGCGGAGAAAGGAGAGGG + Intergenic
1097725184 12:63067070-63067092 GCTTGAAAGCAGAAGGGAGAAGG - Intergenic
1098036553 12:66308701-66308723 TCTTATAAGAAGAAGAGATTAGG - Intronic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1099627506 12:85093493-85093515 TCTTATACAGAGAAGTGAGATGG + Intronic
1099724246 12:86404480-86404502 TCTTATAAGAGGGAGGGAGAGGG + Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1103281893 12:119765118-119765140 TCTTAAAAGGAAAAGAGAGAAGG + Intronic
1104096592 12:125563742-125563764 TCTTATCAGAAAAAAGGAGAGGG + Intronic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1104389004 12:128375544-128375566 CCTTATAAAAAGAAAGGAGAGGG - Intronic
1105785019 13:23739996-23740018 TCTCCTAACCAGAAGGGAAATGG - Intronic
1105891572 13:24685979-24686001 TCTTAGAGGCAGAAGGGACATGG + Intronic
1107634632 13:42379850-42379872 CCTTATAAGAAGAAGAGATAAGG - Intergenic
1107679497 13:42833664-42833686 TCTTATAAGAGGAAAGTAGAGGG + Intergenic
1108476053 13:50818858-50818880 GCTTATAAGAAGAAGGCAAAGGG - Intronic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1112214170 13:97413002-97413024 TCTTCTAGGCAGAAGGAACATGG - Intergenic
1113083251 13:106539178-106539200 TTTCAGAAGCAGATGGGAGAAGG - Intergenic
1113401368 13:109997006-109997028 TCTGATACACAGAAGTGAGATGG + Intergenic
1114307103 14:21433571-21433593 TTTTATAAGGATAAGTGAGATGG - Intronic
1114386022 14:22255809-22255831 TCTCATAGCCAAAAGGGAGAGGG + Intergenic
1114737239 14:25054664-25054686 TCTTAAAAGCAGAGCAGAGAAGG - Intergenic
1115751828 14:36501564-36501586 TCATTTAAGCAGGAGTGAGAGGG - Intronic
1116478318 14:45367030-45367052 TCTTCAAGGGAGAAGGGAGAAGG - Intergenic
1116753922 14:48922037-48922059 TAATAGAAGTAGAAGGGAGAAGG - Intergenic
1118406764 14:65432108-65432130 AGTTATAAGGAGAAGGGAGGAGG - Intronic
1118911610 14:70066484-70066506 TCTTAAAGGCAGAAGGAAGGGGG - Intronic
1119042305 14:71286050-71286072 TCTTATAAAAAGGAGGCAGAGGG - Intergenic
1119153476 14:72387245-72387267 CCTTATAAAAAAAAGGGAGAGGG + Intronic
1119267126 14:73269600-73269622 TCAAATAAGCAGGAGGGAAAGGG + Intronic
1119972534 14:78987787-78987809 AGTTATACACAGAAGGGAGAGGG - Intronic
1120141169 14:80931491-80931513 TCTTATACACAGAAGTGAGATGG + Intronic
1120838263 14:89060479-89060501 TCTTAGAAGAGGGAGGGAGAGGG - Intergenic
1120878131 14:89393239-89393261 TCTTATAAAAAGAAGAGAGGAGG - Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1124555167 15:30718836-30718858 TCTTAAAAGCAGATGAGAGCTGG + Intronic
1124676084 15:31686845-31686867 TCTTAAAAGCAGATGAGAGCTGG - Intronic
1124840033 15:33233054-33233076 TCTTGGAAGCAGAAGAGTGATGG - Intergenic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125270411 15:37932801-37932823 TCTTTCAGGAAGAAGGGAGATGG + Intronic
1125408995 15:39385010-39385032 CCTTATAAGAAGAAGGGACTAGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1126398261 15:48242370-48242392 TCTTATAAGCAGAAGAGGACTGG - Intronic
1126457149 15:48875986-48876008 TCTTACACACAGAAGTGAGATGG + Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127805931 15:62520360-62520382 TCTTCTAAGAAGCATGGAGATGG - Intronic
1127907138 15:63384251-63384273 TCTTTAAAGGAGAAGGGAGAGGG - Intergenic
1127988124 15:64090882-64090904 TAAAATAAGCAGAAGGGAGTGGG + Intronic
1128419809 15:67480929-67480951 TCTTGCAAGCAGAAAGGAAAGGG + Intronic
1129255556 15:74332113-74332135 TCTGATAAGCAGAAAGGACCAGG + Intronic
1130643482 15:85701943-85701965 TCTTATAAAAAGAAGGGGGTAGG + Intronic
1131047403 15:89324861-89324883 TGTTACAAGTAGCAGGGAGATGG - Intronic
1131157061 15:90081779-90081801 TCTTGGAAACTGAAGGGAGAAGG + Exonic
1131534207 15:93220846-93220868 TCTTGTGAGCAAAAGGGACATGG + Intergenic
1131891854 15:96981123-96981145 TCTTATAAGCATCAGGCAGTAGG - Intergenic
1132002969 15:98198417-98198439 TCTGTTAAGTAGAAGAGAGAGGG - Intergenic
1133103732 16:3494084-3494106 TCTTGAAAACAGAAGGGAGGAGG + Intronic
1133196084 16:4171538-4171560 TCCTAAAACCAGAAGGGAGAAGG - Intergenic
1133278001 16:4649565-4649587 TCTTAACAGAAGAAAGGAGAGGG - Intronic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1134433910 16:14237356-14237378 TGTTTCAAGAAGAAGGGAGAGGG + Intronic
1137070791 16:35903118-35903140 ACTTATTAGCAGAAGAGAGTGGG - Intergenic
1137313979 16:47297332-47297354 TCTTATAAGCAGCATGTAGATGG + Intronic
1137717418 16:50606846-50606868 TCTTTCATGCAGAAGAGAGACGG - Intronic
1138691063 16:58769201-58769223 TCTTATAAGCAAGTGGAAGATGG + Intergenic
1138707327 16:58930015-58930037 TTTTTTAAGTAAAAGGGAGAAGG - Intergenic
1138840147 16:60491757-60491779 TCTCTGATGCAGAAGGGAGAAGG + Intergenic
1140009382 16:71115509-71115531 TGTTATAGGAAGAAGTGAGAGGG + Intronic
1140117338 16:72054153-72054175 GCTTTTAAGCAATAGGGAGATGG + Intronic
1140186066 16:72773537-72773559 ACTTATAAGAAGAAGAGATAGGG - Intergenic
1140415893 16:74774018-74774040 TCTTTGAAGCAGAAGTGAGGTGG + Intronic
1140966919 16:79975891-79975913 TCTTTTAAGCAAAAGGAAAAAGG + Intergenic
1141923571 16:87152723-87152745 TCTTATTAGAGGGAGGGAGAGGG - Intronic
1143426658 17:6844990-6845012 ACTAATAAGCAGAAGCGAGGTGG + Intergenic
1144254999 17:13458829-13458851 TCTTTTAATCAAAGGGGAGAAGG - Intergenic
1144589348 17:16511037-16511059 TCTTGCCAGCAGAAGGGAAAAGG - Intergenic
1144663445 17:17086497-17086519 TCTTTTCAGCAGCAGGGAGTTGG + Intronic
1146426656 17:32746382-32746404 TCTTATAGGAAGAAGTGGGAAGG - Intronic
1147383096 17:40067202-40067224 CCTTGTAAGCTGAAGGGCGAGGG - Intronic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148839947 17:50488585-50488607 TCCTATAAGCAGTAAGCAGAAGG + Intergenic
1148946083 17:51262530-51262552 TACTATTAGCAAAAGGGAGATGG - Intronic
1149139986 17:53420672-53420694 TCTTATACACAGAAGTAAGATGG + Intergenic
1150050261 17:61955168-61955190 TCTTATAAGAAGGAGGCAGAAGG - Intronic
1150171834 17:63004465-63004487 TCTTAAAACTAGAAGGGAAAAGG + Intergenic
1150485789 17:65542697-65542719 TCTTAAAAGCAGAATGGTCAAGG + Intronic
1150650280 17:67005669-67005691 TGTGATCAGCAGAAGGGAGACGG - Intronic
1150754872 17:67902538-67902560 TCTCATAAGCTGATGGGAGGAGG - Intronic
1150884029 17:69064407-69064429 TCCTATAAGGAGCAGGAAGATGG - Intergenic
1150943741 17:69722089-69722111 TCTTATTAGCAGAAGGGGTTGGG - Intergenic
1151193771 17:72417181-72417203 TCATATAAGAAGGAGGCAGAGGG + Intergenic
1152733139 17:81983338-81983360 TCCTGCAAGCAGAAGGGAGCAGG - Intronic
1153302598 18:3604345-3604367 TATTAAAAGAAGAAGGGAAATGG - Intronic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1154412253 18:14147848-14147870 TCTCACTAGCAAAAGGGAGAGGG - Intergenic
1154962349 18:21322112-21322134 TATTATAAGCAGAATTCAGAAGG + Intronic
1155112187 18:22726852-22726874 TCTTATACACAGAAGTGAGATGG + Intergenic
1155144525 18:23072119-23072141 TCATATTCGCGGAAGGGAGAGGG + Intergenic
1155552450 18:26979605-26979627 TCTTAGAAGAAGAAGAGAGATGG - Intronic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156823366 18:41399590-41399612 ACCTATAACCAGGAGGGAGAAGG + Intergenic
1157053800 18:44200387-44200409 CCTTATAAGCAGAAGAGATTGGG + Intergenic
1157457075 18:47841940-47841962 TCTTTTAAACAGAAGGCAGACGG - Exonic
1158088493 18:53682625-53682647 TCCTATAAGCAGCAAGCAGATGG - Intergenic
1158915324 18:62120190-62120212 TCTTAAAAGCAGCTGGGGGAAGG + Intronic
1159451325 18:68605788-68605810 TCATAGAAGCAGAGAGGAGAAGG - Intergenic
1159792478 18:72799737-72799759 TCTTACACACAGAAGTGAGATGG + Intronic
1160082599 18:75743458-75743480 TCTTTAAAGCAGAAGGAAAAAGG + Intergenic
1163041244 19:14604209-14604231 TCTAAAAAGCAGAAGGGACCTGG - Intronic
1163415553 19:17184396-17184418 TCTAGTTAGCAGATGGGAGAGGG + Intronic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1167141984 19:47658046-47658068 TCTTTCAAGCAAAAAGGAGAGGG + Intronic
1167809858 19:51819894-51819916 TCTTTTTAGCAGAAAGCAGAAGG + Intronic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925800545 2:7595191-7595213 GCATATAAGCACAAGGTAGAGGG + Intergenic
926537151 2:14127518-14127540 ACTTACAAGCAGAAGGCAAAGGG + Intergenic
926736567 2:16077964-16077986 TCTTATAAGAAGAAGAGATTAGG + Intergenic
926824644 2:16892239-16892261 TCTTATATACAGAAGTGAAATGG + Intergenic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
928146211 2:28778653-28778675 TCTAATAAGCGAAAGTGAGATGG - Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931792499 2:65676998-65677020 TCCTAAAAGCAGATGGGACAGGG - Intergenic
932991546 2:76794247-76794269 TCTTATACTCAGAAGAGAGAAGG + Intronic
933480587 2:82852118-82852140 TCTTATACACAGAAGTGAGTTGG - Intergenic
934577643 2:95413069-95413091 TCTTCTCGGTAGAAGGGAGAAGG + Exonic
934639934 2:96021772-96021794 TCTTCTCGGTAGAAGGGAGAAGG + Intergenic
934793712 2:97083623-97083645 TCTTCTCGGTAGAAGGGAGAAGG - Exonic
937656877 2:124386936-124386958 TCTTATAATCAGAAGCCAGAGGG + Intronic
938709829 2:133966656-133966678 TATGATAAGGAGAAGAGAGAGGG - Intergenic
938942135 2:136178630-136178652 TCTTCAAGGGAGAAGGGAGAGGG + Intergenic
940137668 2:150457454-150457476 TCGTAAAAGCAGAAAGGACAAGG + Intergenic
940485162 2:154288504-154288526 GCTTATAGGCAGAAAGGACATGG - Intronic
940725024 2:157327280-157327302 TCTTCCAAGGACAAGGGAGAGGG - Intronic
941139369 2:161759512-161759534 TCATATAAGCAGAGTGTAGAAGG - Intronic
942074310 2:172342563-172342585 TCTTATAAAAAGGAGGGGGAGGG - Intergenic
942146133 2:173028586-173028608 TCACCTAAACAGAAGGGAGAGGG - Intronic
942258586 2:174133716-174133738 TCTTGTAAGCAGCAGAGAGGTGG + Intronic
942280439 2:174357739-174357761 TCTTAAAAGCAGAAAGGTTATGG - Intronic
942428385 2:175883624-175883646 TCTTTTAATGAGAAGGGAGCTGG + Intergenic
943695679 2:190927692-190927714 CCTTAAAAGCAGAAGGGATGAGG - Intronic
945754797 2:213832556-213832578 TCTTCAAGGAAGAAGGGAGAAGG - Intronic
945801830 2:214442297-214442319 TCTTTTAGGCAGAAGTGAGAAGG + Intronic
946011981 2:216572668-216572690 TTTTATAAACAGAAGGGCAAAGG + Intronic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946989429 2:225311523-225311545 TCTTATAAGTGGGAGGCAGAGGG + Intergenic
947295745 2:228628303-228628325 TCTTATAAGAATGAGGCAGAGGG + Intergenic
948025119 2:234770547-234770569 GCTTATATTCAGAATGGAGATGG - Intergenic
948711458 2:239828071-239828093 TCATATGAGGTGAAGGGAGAGGG + Intergenic
1169489965 20:6063058-6063080 TCTTATAAGAGGGAGGAAGAGGG + Intergenic
1169658170 20:7949367-7949389 TCTTAAAGGCAGCTGGGAGAAGG - Intergenic
1171322709 20:24260459-24260481 TCTTATAGTCAGCATGGAGAGGG + Intergenic
1175825054 20:61932162-61932184 TCTGAGCAGCAGGAGGGAGATGG - Intronic
1176860755 21:14010409-14010431 TCTCACTAGCAAAAGGGAGAGGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177112520 21:17045817-17045839 GCAAATAAGTAGAAGGGAGAGGG - Intergenic
1177665394 21:24150476-24150498 TCTTATAAGCAAAATGGTGATGG - Intergenic
1178596549 21:33958685-33958707 GCTTAATAGCAGAATGGAGATGG + Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1179032402 21:37732023-37732045 TCTTAGATGAGGAAGGGAGATGG + Intronic
1180937227 22:19633678-19633700 TCTTATAAGAAGAAGAGATTAGG + Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1182030384 22:27154887-27154909 TCTTATCAGCAGAAGGCACCTGG + Intergenic
1183114834 22:35683388-35683410 CCTTATATGCAGATTGGAGAAGG + Intergenic
1183998012 22:41650606-41650628 TCTTCTAAGGAGCAGGAAGATGG - Intronic
1184174754 22:42782005-42782027 GCTTCAAAGCAGAAGGCAGAAGG - Intergenic
1184495768 22:44840438-44840460 TCTAGTGAGCAGAAGGGAGAGGG - Intronic
949239913 3:1858807-1858829 TCTATTAAGCAGAGAGGAGAGGG + Intergenic
949832799 3:8233970-8233992 CCTTTTAATCAAAAGGGAGATGG + Intergenic
950758489 3:15198637-15198659 TCTTATACACAGAAGTGAGGTGG - Intergenic
951739984 3:25911021-25911043 TCTTATAACCATAAGGCAGAGGG + Intergenic
952809770 3:37391414-37391436 TCTTTTAAGAAGAAAGGAGAAGG + Intronic
952813294 3:37424345-37424367 TCCTTTATGCAGAAGGCAGATGG - Intronic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
956585970 3:70865397-70865419 TCTTGCAAGAAGAAGGCAGAAGG - Intergenic
957219496 3:77363745-77363767 TCTTCAAGGAAGAAGGGAGAAGG + Intronic
958728306 3:97932910-97932932 TATTTTTAGCAGAAGGGAGCAGG - Intronic
958753714 3:98224776-98224798 TCTTATAAGGTGAATGCAGAAGG + Intergenic
959010889 3:101074629-101074651 TCTTATAAGTAAAAGGCAGAGGG + Intergenic
959119024 3:102211114-102211136 TTTTATAAACAGAAGGAAGGTGG + Intronic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959837148 3:110932769-110932791 TCTTCTCAGGAGAAGGGACATGG - Intergenic
961135262 3:124504282-124504304 TTTTTTAAACAGAAGGAAGAGGG - Intronic
961648660 3:128406315-128406337 TCATAGAAGCAGAGGGTAGAAGG + Intronic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962485234 3:135835996-135836018 TCTTATAGGAAAAAGTGAGATGG + Intergenic
962888469 3:139650177-139650199 TATTATATGGAGAAGAGAGAGGG - Intronic
963476122 3:145806776-145806798 TTTTATAATCAGCAGGGAAAGGG + Intergenic
963537539 3:146546413-146546435 TCTTATACACAGAAATGAGATGG - Intergenic
963617779 3:147564700-147564722 TCTTATAAGCAGAATAAAGTTGG - Intergenic
963929784 3:150991802-150991824 TCTCAGAAGCTGAGGGGAGATGG - Intergenic
964037833 3:152219921-152219943 TATTAGAAGTAGAAGGCAGACGG + Intergenic
964062592 3:152541568-152541590 TCTTATAAGCAGTATGCAGTTGG - Intergenic
964241541 3:154600812-154600834 GCTCATAAGCAGAAGGGACTAGG - Intergenic
964742502 3:159982457-159982479 TCATATCAGCAAAATGGAGATGG - Intergenic
964793292 3:160472763-160472785 TCAGATAAGCAGAAGAGACACGG + Intronic
965176000 3:165333320-165333342 TCCTATAAGCAGACTTGAGAGGG - Intergenic
966958158 3:184906607-184906629 TCTTAGGGGTAGAAGGGAGATGG + Intronic
967789766 3:193534768-193534790 TCCTAGAAGGAGAGGGGAGAGGG + Intronic
967859867 3:194142262-194142284 GGTTAGAAGCAGAAGGGTGAGGG + Intergenic
968890593 4:3366605-3366627 TCTCAACAGCAGAAAGGAGACGG - Intronic
969036011 4:4254618-4254640 TCCTATAACCAGAAAGAAGAGGG + Intergenic
969051583 4:4377066-4377088 CCCTATAAGAAGAAGGGACATGG - Intronic
970790620 4:19854013-19854035 TCTCATAAGCAGAAGGGACTAGG - Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971526866 4:27630572-27630594 CCTTATAAGAATAAGGGATAAGG - Intergenic
972427859 4:38951499-38951521 GCTTATAACCAGAAGTGAAAGGG + Intergenic
973942346 4:55923801-55923823 TCCTCTAAGTAGAAGGGCGATGG + Intergenic
975417393 4:74120751-74120773 TCTTATATACATAAGTGAGATGG + Intronic
975625292 4:76339923-76339945 TCTTATACACAGAAGTGAGATGG + Intronic
976019759 4:80607384-80607406 TCTTAAAAGCAAAAAGTAGAGGG + Intronic
976180295 4:82392468-82392490 TCTTATACACAGAGGTGAGATGG + Intergenic
976566229 4:86553538-86553560 TCTTTTAAGCAGCTGGGATAAGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977853923 4:101864918-101864940 TCTTTAAGGCAGAAGAGAGAAGG + Intronic
979066258 4:116137687-116137709 TCATATAAGCAGAGAGCAGAAGG - Intergenic
979623313 4:122819724-122819746 TCTTATACACAGAAGTGAGATGG - Intergenic
979829176 4:125279497-125279519 TCTTATACACAGAAGGGAGATGG + Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980470649 4:133247399-133247421 TCTAATAACCAGGTGGGAGAGGG - Intergenic
980870387 4:138604618-138604640 TCTCAGAAGCAGAGAGGAGAAGG - Intergenic
980925536 4:139133226-139133248 TCTTATAAGCAATAAGGATAAGG + Intronic
982167417 4:152627271-152627293 ACATATAAACCGAAGGGAGATGG - Exonic
982709331 4:158744467-158744489 TCTTCTAGGGAGAAGAGAGAAGG + Intergenic
983061356 4:163165373-163165395 TTTTGAAAGCAGAAGGGATATGG - Intronic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
987316435 5:16728941-16728963 TCTTTTAAGCAGCAGCAAGAAGG + Intronic
988618963 5:32803010-32803032 TTTTATAGGCAGGATGGAGAAGG - Intergenic
989705252 5:44322071-44322093 CCTTATACACAGAAGTGAGATGG + Intronic
990463363 5:56049492-56049514 TCATATAAGCAGGAAGGACAAGG - Intergenic
990601002 5:57358630-57358652 TGTTGTTACCAGAAGGGAGATGG - Intergenic
991981655 5:72237866-72237888 TCTTATTAACAGAATGGAGCTGG - Intronic
992707124 5:79407721-79407743 TCATAGAAGGAGAAGAGAGAAGG + Intronic
992855167 5:80852753-80852775 CCCTATAAGAACAAGGGAGATGG - Intronic
993690809 5:90997017-90997039 GCTTATAGGCAGAAGGGACTTGG + Intronic
994211830 5:97095545-97095567 TGGTATTAGCACAAGGGAGATGG + Intronic
994911984 5:105921644-105921666 CCTTACAAGCAGAAGTGAAAAGG + Intergenic
995463972 5:112431748-112431770 TCTCATACACAGAAGTGAGATGG - Intergenic
995495931 5:112743218-112743240 TCTTTTAAGAAGGAGGCAGAAGG - Intronic
995861492 5:116645456-116645478 TCTTATACACAGAAGTGAGATGG - Intergenic
997621020 5:135295368-135295390 TAATATAAGCAGAAGGAATAGGG - Intronic
997685699 5:135786226-135786248 TCGTATATTCAGAGGGGAGAGGG + Intergenic
998604069 5:143615613-143615635 TCTTAAAAGGAGAAGAAAGAAGG - Intergenic
998950144 5:147385526-147385548 TGTAGTAAGCACAAGGGAGAAGG - Exonic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000288163 5:159845993-159846015 TCTTATTTGCAGCTGGGAGAGGG - Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003331116 6:5129540-5129562 TCTTCTAAGAGGAAGGCAGAGGG - Intronic
1003380465 6:5620369-5620391 TGTTATGAGCAGTGGGGAGAAGG + Intronic
1003682478 6:8269566-8269588 TCTTACAAGAGGAAGGGAGAGGG + Intergenic
1004389563 6:15198666-15198688 TCTTTTAAAAAGGAGGGAGATGG + Intergenic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1006046133 6:31300335-31300357 CCTTGTTAGCAGATGGGAGAGGG - Intronic
1006486300 6:34345361-34345383 TTTTAAAAGCTGAAGGGAGTCGG + Intronic
1007033037 6:38646383-38646405 TCTAAAAAGCAGATGGTAGAGGG - Intergenic
1007336344 6:41157613-41157635 TCTTAAATGCAGAAGCCAGAAGG - Intergenic
1007603979 6:43103234-43103256 TTTTAAACTCAGAAGGGAGAAGG - Intronic
1008524001 6:52389412-52389434 TTCAATAAGCAGAAGAGAGAAGG + Intronic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1009674209 6:66795893-66795915 TCTTATACTCAGAAGTGAGATGG - Intergenic
1010179008 6:73063124-73063146 TTTTATAAGGAGACTGGAGATGG - Intronic
1010477631 6:76308051-76308073 GCTTATAATCAGAATGGAAAGGG - Intergenic
1011083812 6:83516820-83516842 TCATATAAGAAGGAGGCAGACGG - Intronic
1011253822 6:85401346-85401368 TTTAAGAAGCAGAAGAGAGAGGG + Intergenic
1012346889 6:98199268-98199290 TCTTATAAGAAAAAGAGAAATGG - Intergenic
1012614486 6:101260038-101260060 TCTTATACTCAGAAGTGAGATGG + Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1013036124 6:106385202-106385224 TCTTATACACAGAAGTGAGATGG - Intergenic
1013993586 6:116281085-116281107 TCTTATAAGAAGGAGGCAGGAGG + Intronic
1015498003 6:133900940-133900962 CCTTATAAGAGAAAGGGAGAGGG + Intergenic
1016442543 6:144098661-144098683 TCTTATACACAGAGGTGAGATGG - Intergenic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1017999728 6:159568498-159568520 TACTATAACCAGAAGGGAGAAGG + Intergenic
1018238897 6:161753483-161753505 TCTTAGAAGCAGTACGAAGAAGG + Intronic
1019918775 7:4149880-4149902 TCTCGAAAGCAGCAGGGAGATGG + Intronic
1020039078 7:4987570-4987592 TCCTAAAAACAGGAGGGAGAAGG - Intronic
1020156216 7:5726893-5726915 TCCTAAAAACAGGAGGGAGAAGG + Intronic
1020339468 7:7094343-7094365 TGTGGTAAGCAGAAGAGAGATGG - Intergenic
1020727465 7:11833236-11833258 TATTATTAGCTAAAGGGAGAAGG - Intergenic
1021144044 7:17063649-17063671 TCTAATAAGGAGAAGAGAGAAGG + Intergenic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1022538515 7:31113850-31113872 ACTTAGAAGCAAATGGGAGAAGG + Intergenic
1023056121 7:36291433-36291455 TCGTACCTGCAGAAGGGAGATGG + Intronic
1024406175 7:48983316-48983338 TCTCAAAAGCAGAGGAGAGAAGG - Intergenic
1025137781 7:56434919-56434941 TCTTATAGGTAGCAGGGAGTAGG - Intergenic
1025234334 7:57223846-57223868 TTTTATAAGAAGAAAGGAGTAGG + Intergenic
1026799574 7:73391162-73391184 TCTTAGAAGCAGTTTGGAGAGGG - Intergenic
1027403353 7:77831956-77831978 TCTTATATGCAGAAGTAAGATGG + Intronic
1027481091 7:78697908-78697930 TCTTATAAGGAGAAGTGAATAGG - Intronic
1027733829 7:81907608-81907630 GCTTGTATGCAGAAGGGAGTTGG - Intergenic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1030105952 7:105987529-105987551 TCGTAAAAGTAGAAGGGAGGTGG + Intronic
1030749607 7:113215197-113215219 TCTTATGGGAAGAAGGGAGCTGG - Intergenic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1032668285 7:134060191-134060213 TATTATAAGCAGATAGGTGAGGG - Intronic
1033447676 7:141436781-141436803 TATTTTTAGCAGAAGGGAGAGGG - Intronic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1033679792 7:143583234-143583256 GCTTATATGTAGAATGGAGAAGG - Intergenic
1033692043 7:143746209-143746231 GCTTATATGTAGAATGGAGAAGG + Intergenic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035947126 8:3977651-3977673 TCTTATGAGCAGAAAGGAGAAGG - Intronic
1036744109 8:11391752-11391774 TCTCAGAAGCGTAAGGGAGATGG + Intronic
1037023180 8:13999235-13999257 TCTTATACACAGAAGTGAGATGG - Intergenic
1038057520 8:23874663-23874685 TATTATAAGCATCAGAGAGAAGG - Intergenic
1038239105 8:25791623-25791645 GTATATATGCAGAAGGGAGATGG + Intergenic
1038660603 8:29493420-29493442 TCTTACAAGAAGAAGAGAGGAGG + Intergenic
1038765243 8:30422039-30422061 TCTTAAAAGCAGTAGGGGGCTGG + Intronic
1039650095 8:39332313-39332335 TCTTATAGGCAGGATGGAGGAGG + Intergenic
1039719612 8:40149291-40149313 TCTTATAAGAAGGAGTCAGAAGG - Intergenic
1040737801 8:50531757-50531779 TCTTAGGAGCAGAGGTGAGATGG - Intronic
1040802308 8:51356756-51356778 TCTTTTAAGGAAAAGGGAAAAGG - Intronic
1041107251 8:54455190-54455212 TGTTATAAGAAGTAGGGGGAGGG + Intergenic
1041550479 8:59095089-59095111 TGTTCTAAGCATAAGGGACAAGG + Intronic
1041570998 8:59336804-59336826 TCTTATAAGAAAGAGGCAGAGGG + Intergenic
1042452183 8:68960524-68960546 TCTTTTAGGGAGAAAGGAGAGGG - Intergenic
1043484805 8:80688329-80688351 TGTAATAAGCAGAATGGAAAGGG - Intronic
1043783247 8:84363323-84363345 ACTCAGAAACAGAAGGGAGATGG + Intronic
1043852329 8:85229072-85229094 TCTTATAAGGAGGAGAGAGACGG - Intronic
1045571813 8:103375462-103375484 TATAATGAGCAGAAGGGAGCAGG + Intronic
1046579687 8:116076991-116077013 TCGTAAAAGCAATAGGGAGATGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1047117663 8:121862457-121862479 TCTTATGATCAGAAAAGAGAAGG + Intergenic
1047266247 8:123312162-123312184 GATTTTATGCAGAAGGGAGAAGG - Intergenic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1050676495 9:8061505-8061527 TCTTATAAGCAGGATGTAGTTGG + Intergenic
1051035065 9:12734538-12734560 CCTTATAAGCAAAAGGCAGCAGG + Intergenic
1051245019 9:15101304-15101326 TGTTATCAGCCGAAGGGGGAAGG - Intergenic
1051360570 9:16278150-16278172 TGTTATAGGCAGGAGGGAGGGGG - Intergenic
1051548520 9:18303739-18303761 TCTAATGAGGAGAAGGGTGATGG + Intergenic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1053052518 9:34973603-34973625 TCGTCTAAGCAGCAGGAAGAAGG - Intronic
1054983501 9:71234627-71234649 TCTTATAAGAAGAAGAGATTAGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055689273 9:78811730-78811752 TCTCCTAAGTACAAGGGAGAGGG + Intergenic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1056512089 9:87315931-87315953 TCTTATAAGAGGGAGGGAGAGGG + Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057863424 9:98660828-98660850 TCTTATAAGAAGGAGGCAGGAGG - Intronic
1058838458 9:108881017-108881039 TCTTAAAAGCAAAGTGGAGAAGG - Intronic
1062202152 9:135309268-135309290 TCCTAGAAACAGAAGGGACAAGG - Intergenic
1185853484 X:3510707-3510729 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1187788698 X:22923299-22923321 TGTTTTAACCAGAAGGCAGAAGG - Intergenic
1188152485 X:26695197-26695219 TCTTATAAGAGGGAGGCAGAAGG + Intergenic
1188520910 X:31036679-31036701 TCCTATAAGTAGCAGGGAGGTGG - Intergenic
1189209076 X:39267507-39267529 TCTTATAGGCAAGAGAGAGAAGG - Intergenic
1189943292 X:46150900-46150922 TTTTCTAAGCAGAAAGGAAATGG - Intergenic
1191699884 X:64030326-64030348 TCCCAGAAGAAGAAGGGAGAGGG - Intergenic
1193703231 X:84789694-84789716 GCTTAAAAGCAGACTGGAGATGG + Intergenic
1194230772 X:91320803-91320825 TCCTACAAGCAGAAGAGAGTGGG - Intergenic
1194265248 X:91745135-91745157 TCTTATGAGAACAAGGCAGAGGG + Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1195116771 X:101707164-101707186 GCAGATAACCAGAAGGGAGATGG + Intergenic
1196384849 X:115138206-115138228 TCTTAAAGGGAGAAGGGAGGAGG - Intronic
1197716130 X:129707212-129707234 TCTAAGAATCAGAGGGGAGAAGG - Intergenic
1198263113 X:134984159-134984181 TCTTCTAAGAAGAAGGGATTAGG - Intergenic
1198982951 X:142420025-142420047 TCTTCATAGCAGAAGGGAGATGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199402516 X:147415662-147415684 TCTTATAAGAGGAAAGGAGGAGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199959528 X:152768250-152768272 TCCTATAAGGAGAAAGGTGAGGG - Intronic
1200582400 Y:4965583-4965605 TCTTATGAGAACAAGGCAGAGGG + Intergenic
1200809948 Y:7473819-7473841 TCTTATAAGAAGAGGAGATAAGG - Intergenic
1201232711 Y:11880116-11880138 TCTCATAAGAAGAGGGGATAAGG + Intergenic