ID: 908732635

View in Genome Browser
Species Human (GRCh38)
Location 1:67242150-67242172
Sequence ATGCCCTGCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908732633_908732635 18 Left 908732633 1:67242109-67242131 CCTCTTTTACTTCAAACTATGGA 0: 1
1: 1
2: 17
3: 47
4: 212
Right 908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908732635 Original CRISPR ATGCCCTGCTAGAAGAGTGA AGG Intronic
No off target data available for this crispr