ID: 908741154

View in Genome Browser
Species Human (GRCh38)
Location 1:67328988-67329010
Sequence AGAAGCACATAGTGTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908741154_908741156 -6 Left 908741154 1:67328988-67329010 CCAACCTCACACTATGTGCTTCT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 908741156 1:67329005-67329027 GCTTCTCGCCTCTCTTTCCATGG 0: 1
1: 0
2: 1
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908741154 Original CRISPR AGAAGCACATAGTGTGAGGT TGG (reversed) Intronic
901744886 1:11365832-11365854 AGAAGCAGATGGAGTGAGGAAGG - Intergenic
901832612 1:11902295-11902317 TCAAGCACAAAGTGTGAGGATGG - Intergenic
902697076 1:18147292-18147314 AGAATCAAACAGGGTGAGGTGGG - Intronic
903419825 1:23210687-23210709 AGAAGCATATAGTGTGAAATGGG - Intergenic
904698703 1:32345587-32345609 AGAAGCCCAGAGTGTGTTGTGGG - Intergenic
906441954 1:45854929-45854951 AGAAGCACATAGGATGAGGCAGG + Intronic
907831709 1:58070635-58070657 TGAAGTACATTGTGTGAGATGGG + Intronic
908002738 1:59696647-59696669 TGAAGGACACAGTGTGAGGTAGG - Intronic
908009225 1:59758763-59758785 AGAAACACAAAGTATGAGATGGG + Intronic
908741154 1:67328988-67329010 AGAAGCACATAGTGTGAGGTTGG - Intronic
910662481 1:89688626-89688648 AGAGGCACATAGTGAAAGGAAGG + Intronic
917814905 1:178698379-178698401 AGAAAAACATAGTTGGAGGTAGG - Intergenic
919948537 1:202341107-202341129 AGACGCACAGAGGGTGACGTTGG - Intronic
920540708 1:206775909-206775931 AGAAGCTCACAGTGTGAGAGTGG - Intergenic
921248973 1:213278639-213278661 AGAAGCCCATAATGGGAGGGAGG - Intergenic
923518209 1:234715371-234715393 AGAAGCGTGTAGTGTGTGGTGGG - Intergenic
924624886 1:245689323-245689345 AGAAGCCCCTCCTGTGAGGTTGG + Intronic
1063420208 10:5906456-5906478 AGAAGCCCATAGTATGAGTCAGG - Exonic
1065446276 10:25804801-25804823 AGAAGCACAAACAGTGAGTTAGG + Intergenic
1065992279 10:31023878-31023900 GGAAGCACAGAGTTTGAGATTGG - Intronic
1072702183 10:97650634-97650656 TGAAGCACAAAGTTAGAGGTAGG + Intronic
1073862325 10:107761215-107761237 AGAAGAAAAGAGTGGGAGGTGGG + Intergenic
1075682402 10:124342149-124342171 AGAAGCACAAATGGTGACGTGGG - Intergenic
1076316776 10:129547549-129547571 ACAAGCTCATAGTGTGTGCTGGG + Intronic
1076922470 10:133461591-133461613 AGAAACACAGATTGTGACGTGGG - Intergenic
1077868621 11:6243024-6243046 AGAAGCGCAGAGTGTGGGGAGGG - Intronic
1077944649 11:6882655-6882677 AGAAGAAAATACTGTCAGGTTGG - Intergenic
1078974818 11:16461530-16461552 GGAAGCACATAGTATGGGATAGG - Intronic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1080100333 11:28452307-28452329 AGAAAAACACATTGTGAGGTTGG - Intergenic
1080845281 11:36021412-36021434 AGAAGAATATGGTGTGAGGGTGG + Intronic
1081210889 11:40332346-40332368 AGACACACATAGTGGGAGGAAGG - Intronic
1081730642 11:45369649-45369671 CGAAGCCCACAGTGGGAGGTGGG - Intergenic
1083275760 11:61596118-61596140 AGTGCCACATAGTGTGAGGCTGG + Intergenic
1085512676 11:77096183-77096205 AGAATCCCCAAGTGTGAGGTGGG - Intronic
1086385205 11:86300148-86300170 AGAATCATATAGTTTGAGATGGG + Intergenic
1088130296 11:106480706-106480728 TGAAGCTCAGTGTGTGAGGTGGG + Intergenic
1088399857 11:109411669-109411691 AGAGTCACATAGGGAGAGGTGGG + Intergenic
1089014918 11:115157838-115157860 AGAAGCACATACTGTGTGCCAGG - Intergenic
1090556130 11:127878496-127878518 AGAAACACACAGAGTGAGGTAGG + Intergenic
1091187108 11:133656816-133656838 AGCAGCAGAGAGTGTGGGGTGGG - Intergenic
1091936168 12:4435915-4435937 AGAAGAACAGAGAGCGAGGTGGG + Intronic
1092732317 12:11546444-11546466 AGAAGCACATAGTGTTAGTAAGG - Intergenic
1093139756 12:15495619-15495641 TCAAGCACAAAGTGTGAGGCTGG + Intronic
1097237927 12:57552328-57552350 AGAGACACACAGTGGGAGGTGGG + Intronic
1099343415 12:81467907-81467929 AGGAGCCCAAAGGGTGAGGTGGG - Intronic
1101259435 12:103013504-103013526 AGAGGCACCTAGTTTGGGGTGGG + Intergenic
1101438291 12:104682923-104682945 AGAAGGACAGAGAGTCAGGTGGG - Intronic
1101862131 12:108491284-108491306 AGAAGCACATAGAATAAGGAGGG - Intergenic
1101936886 12:109065448-109065470 TGAAGCACAAAGTGTGAAGGCGG + Intronic
1103860715 12:124010962-124010984 GGAAGCACAGGGAGTGAGGTGGG + Intronic
1105720450 13:23108348-23108370 GGAACCACATAGTGGGAGGGAGG - Intergenic
1110739686 13:78980000-78980022 ACAAGATCAAAGTGTGAGGTTGG + Intergenic
1113874746 13:113587168-113587190 AGCAGCATGTAGTGTGAGGCTGG + Intronic
1115404463 14:32998961-32998983 TGAAGCACACAGTGTGATGATGG - Intronic
1116836747 14:49776039-49776061 AGGAGCATATGGTGTTAGGTAGG + Intronic
1118187613 14:63551473-63551495 AGAATCACATAAAGTGAGGGAGG - Intergenic
1118395734 14:65334878-65334900 AAACCCACCTAGTGTGAGGTGGG - Intergenic
1121369773 14:93346792-93346814 AGAGATACTTAGTGTGAGGTGGG + Intronic
1121895117 14:97639727-97639749 AGAAGTGCAAAGTGAGAGGTGGG - Intergenic
1126423480 15:48500597-48500619 ATAAACACATAGTGAGGGGTAGG + Intronic
1128561690 15:68672866-68672888 AGAGCCACATAATGTGAGCTCGG + Intronic
1129771249 15:78204760-78204782 AGAAGCTCACAGTTTGAGGCCGG - Intronic
1129825063 15:78629424-78629446 AGAGGCACATCGAGGGAGGTGGG + Exonic
1129948481 15:79562913-79562935 AGGGACACGTAGTGTGAGGTAGG + Intergenic
1130948321 15:88566251-88566273 TGAAGCACAGAGAGTCAGGTGGG + Intergenic
1131054049 15:89365248-89365270 AGAAGCGCATTGTGTGGGCTGGG - Intergenic
1131115320 15:89791793-89791815 TGAGGCACATGGTGGGAGGTGGG + Intronic
1133847224 16:9466567-9466589 AGAAGCATATAGTCTAAGCTGGG + Intergenic
1134044473 16:11091183-11091205 AGCAGCTCATGGTGTGAGTTGGG - Intronic
1134629905 16:15749070-15749092 GGAATCAGATGGTGTGAGGTAGG - Intronic
1135350896 16:21728158-21728180 AGAAACACATCCTGTGGGGTGGG - Intronic
1136084448 16:27874716-27874738 AGAAACACATAGGGCAAGGTTGG - Intronic
1136924848 16:34362410-34362432 AGAAGCAAATAGGGTGATATAGG - Intergenic
1136979725 16:35049396-35049418 AGAAGCAAATAGGGTGATATAGG + Intergenic
1141378358 16:83552261-83552283 AGAAGAGCATAGTTTGAGGGAGG + Intronic
1141454463 16:84130841-84130863 AAAAGCACATAGTAGGAAGTGGG + Intronic
1143340205 17:6205163-6205185 AGAATCACATAGTGTTAGCATGG - Intergenic
1146474808 17:33154145-33154167 AGAAGTACATTGTCTGAGGTTGG - Intronic
1155313066 18:24543912-24543934 GGAAGCACAGTGTGTGAGGATGG - Intergenic
1155359362 18:24984750-24984772 TGGAACAAATAGTGTGAGGTGGG - Intergenic
1156610596 18:38719347-38719369 CTAAGGACATAGAGTGAGGTGGG + Intergenic
1157195914 18:45619995-45620017 AGGAGCACAGGCTGTGAGGTGGG - Intronic
1157199372 18:45646162-45646184 AGAACAACAGAGTGAGAGGTTGG - Intronic
1159271520 18:66158841-66158863 AGAAGAACATAGTGGAAGGATGG - Intergenic
1160963233 19:1734058-1734080 AGAGGCTCACAGTGTGAGGGTGG - Intergenic
1163528008 19:17832917-17832939 AGGAGCTCATAGTCTGGGGTGGG + Exonic
1164550669 19:29209517-29209539 AAAAGCACATAGAGTGATTTTGG - Intronic
1165594499 19:37000744-37000766 AGGAGCACACAGGGTGAAGTCGG - Intergenic
1166443274 19:42834977-42834999 AGAAGCACATCATGTGCTGTAGG + Intronic
1166887131 19:45968643-45968665 TGAAGCACATAGCGTAAGGCTGG - Intronic
1167747955 19:51363900-51363922 AGAAGCACAAAGGGTAAGGGAGG + Intronic
925102882 2:1264293-1264315 TGGAGCACATAGTGTGACATGGG + Intronic
925440547 2:3881554-3881576 AGTGGGACCTAGTGTGAGGTGGG + Intergenic
926834291 2:17000479-17000501 AGAGGAACCTAGTGTAAGGTAGG - Intergenic
927328950 2:21840274-21840296 AGGAGCACAGAGTGTGAGCCTGG - Intergenic
928576981 2:32665140-32665162 AGAAGCACAGAATGTGGGCTGGG - Intronic
928880984 2:36096187-36096209 AGCAGGAGATAGTGGGAGGTTGG - Intergenic
929625208 2:43399619-43399641 AGCAGCACATAGTTTCAGGATGG + Intronic
929996333 2:46828430-46828452 AGAGGCACAGAGTGAGAGGGAGG - Intronic
930013885 2:46957720-46957742 TGAAGCACAAAGTTTGGGGTAGG - Intronic
932125577 2:69142808-69142830 CAAAGCACAAAGTGTGAGGAGGG + Intronic
932457421 2:71858323-71858345 AACAGCACACAGTGTGTGGTGGG - Intergenic
933628575 2:84631113-84631135 AGAAGCAAATAGTCTGAGTCAGG - Intronic
938686992 2:133748141-133748163 AGGAGCACATGGTGTGGGGGAGG - Intergenic
942595341 2:177586969-177586991 ACAAGCACATAGTGGCAGTTTGG + Intergenic
943682848 2:190786248-190786270 TCAAGCACCTGGTGTGAGGTAGG + Intergenic
945504017 2:210615115-210615137 ACAAGCACATACAGTGAGGGAGG - Intronic
945542458 2:211105573-211105595 AGAAGCACATGGGGTGTGGTAGG - Intergenic
946350129 2:219145343-219145365 AAAAGCAAAAAATGTGAGGTAGG - Intronic
948582711 2:238998737-238998759 AGAAGCACATGGGGTGTGGAGGG + Intergenic
1169673127 20:8126400-8126422 AGAAGGAAATAGGGTGAGGTGGG + Intergenic
1171091198 20:22287227-22287249 GGAAGCATATATGGTGAGGTGGG - Intergenic
1171392693 20:24811640-24811662 TGAAGCAGACAGTGTCAGGTGGG - Intergenic
1174526881 20:51179470-51179492 AGAAGTATATGGTATGAGGTGGG - Intergenic
1175327113 20:58137570-58137592 AGGAGCACAGATTGTGAGGAGGG + Intergenic
1178588509 21:33889446-33889468 ACAAGCATATTATGTGAGGTTGG - Exonic
1178904942 21:36628857-36628879 AAAAGCAAACAGTGTGAGCTGGG + Intergenic
1179261920 21:39765084-39765106 AGAAGAACATCATGTGAGGACGG - Intronic
1179269322 21:39838216-39838238 AGAACCACATGGGGGGAGGTAGG - Intergenic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1181181741 22:21073364-21073386 AGAAGCACTTAATGTGAGGGTGG - Intergenic
1181426959 22:22849953-22849975 AGAAGCAGATAAAGTGAGCTGGG + Intronic
1183915714 22:41117069-41117091 AGAAAAACATGGAGTGAGGTTGG + Intronic
1184989972 22:48160819-48160841 ACAAGCACACAGTGAGAGGGTGG - Intergenic
949124123 3:425087-425109 AGAAGCACATAGTCTACTGTCGG - Intergenic
951132757 3:19068085-19068107 AGCAGGACAGAGAGTGAGGTGGG - Intergenic
953361562 3:42301662-42301684 AGAAGCACATAGTTTAGGCTTGG - Intergenic
955204879 3:56886888-56886910 GGAAGCACATAGTTTGAAGTAGG - Intronic
955537641 3:59941374-59941396 AGAAGAAAACAGTGAGAGGTGGG - Intronic
956075997 3:65506351-65506373 AGAAGCACAGAGTATGTTGTTGG - Intronic
956823154 3:72972348-72972370 AGAAGCATATATTCTGAGCTGGG + Intronic
958744796 3:98119466-98119488 AGAAGCACATGGTCTGAGTGTGG + Intergenic
959051657 3:101530292-101530314 AGACACACAGAGGGTGAGGTTGG + Intergenic
959900359 3:111654236-111654258 AGAAACACATAGTGAGAATTGGG + Intronic
960925600 3:122792912-122792934 AGGAGCGAATAGTTTGAGGTCGG - Intronic
967991759 3:195136714-195136736 AGAAGCACACAAGGTGAAGTGGG + Intronic
974055953 4:56983178-56983200 GGAAGCACAGATTGTGAAGTTGG - Intronic
974369074 4:60990414-60990436 CAAAGCACAGAGTGTGAGGCTGG - Intergenic
974832665 4:67208879-67208901 AGAAGCACAAAGTGTGTTGATGG + Intergenic
975093138 4:70426365-70426387 AGAGGGACATAGTGGGAGGTGGG + Intergenic
978190854 4:105909796-105909818 AGAAGTACATTGTGTCAGGGAGG + Intronic
981775295 4:148360301-148360323 GAAAGCACATAGTGTCATGTAGG - Intronic
985497273 5:216456-216478 AGAAGCATTTTGTGTGGGGTGGG - Intronic
985738307 5:1598500-1598522 AGAAGCATTTTGTGTGGGGTGGG + Intergenic
986287915 5:6373649-6373671 AGAGGCACCTATTGTGAGCTGGG + Intronic
991035758 5:62125814-62125836 AGAAGCTCATTGTGTGAGTCTGG + Intergenic
991052339 5:62286722-62286744 AGAAACACAGATTCTGAGGTTGG + Intergenic
991225246 5:64262906-64262928 AGAAGCACATATTTTGCAGTGGG - Intronic
992334632 5:75753176-75753198 AGAAGCAGATCTTCTGAGGTGGG - Intergenic
994286624 5:97976615-97976637 AGAGCCACAAAGTCTGAGGTTGG - Intergenic
996155234 5:120091012-120091034 AGAAGCACTTTATGTGAGGAAGG + Intergenic
997633104 5:135384988-135385010 AGAAGCACCTAGTCCTAGGTTGG + Intronic
997915266 5:137918351-137918373 AGAAGAATAAAGTGAGAGGTAGG + Intronic
998339599 5:141405158-141405180 ACACCCACAAAGTGTGAGGTGGG - Exonic
999642306 5:153683856-153683878 AGAAGCAGATAGTTTGAGCAAGG + Intronic
1000221325 5:159217434-159217456 AAATGCAAATAGTGTGAAGTGGG + Intergenic
1000973055 5:167736165-167736187 AGAAGTACAGAGTGAGGGGTGGG + Intronic
1002326335 5:178410234-178410256 ATAAACACAAAATGTGAGGTTGG - Intronic
1003023602 6:2533330-2533352 AAAAGCACAAAAAGTGAGGTGGG + Intergenic
1004021231 6:11777320-11777342 AGCCACACATAGTGTGAGGTAGG + Intronic
1004804492 6:19187846-19187868 AGAAGCACAGAGTCTGAGGGGGG - Intergenic
1006104989 6:31711065-31711087 AGAAGCACAAAGTGGGAGGATGG + Intronic
1006401617 6:33821106-33821128 AGAAGGATAGAGTGTGTGGTGGG + Intergenic
1006784568 6:36657193-36657215 AGAGAAACATAGGGTGAGGTTGG - Intergenic
1006919767 6:37619641-37619663 AGAAGCTCCTAGCCTGAGGTAGG + Intergenic
1007791616 6:44312266-44312288 GGAAGCACATAGAGTGGGGAGGG + Intronic
1010216284 6:73404754-73404776 AGAAGCAGATAGTTGGAGGTGGG + Exonic
1010379988 6:75213353-75213375 AGAAGCAGATAGAGGGAGGCTGG - Intergenic
1011453641 6:87523330-87523352 AAAAGAACAGAGTGTGAGGCTGG - Intronic
1011718701 6:90133165-90133187 AGAAGGACAAAGGATGAGGTGGG - Intronic
1011799090 6:90990857-90990879 AGATGTACATACTTTGAGGTTGG - Intergenic
1015818881 6:137239005-137239027 AGAGGAACAGAATGTGAGGTTGG - Intergenic
1016109766 6:140208113-140208135 AGAAGAACTTAGTGTGTGCTAGG + Intergenic
1017398906 6:154036878-154036900 AGAAACACAGAGAGTGAGGGAGG + Intronic
1018193606 6:161334422-161334444 AGAAGCACAGAATGTTATGTTGG - Intergenic
1018379529 6:163245680-163245702 AGAAGCTCAGAGTGTGTGGTGGG - Intronic
1021496888 7:21284737-21284759 AGAAGGAGATGGTCTGAGGTGGG + Intergenic
1023168459 7:37366630-37366652 AGAGGCTCATTGTGTGAGGACGG - Intronic
1024194626 7:47047071-47047093 AGAAGCACAAAGTATGAACTTGG + Intergenic
1025031041 7:55557101-55557123 ATAAGTACAAAGTGTGAGGTAGG - Intronic
1029860503 7:103566522-103566544 AGAAACACACAGTGCAAGGTGGG + Intronic
1030360332 7:108588740-108588762 AAAAAAACATATTGTGAGGTGGG - Intergenic
1031046733 7:116897809-116897831 AAAACCGCAGAGTGTGAGGTAGG - Intronic
1033458649 7:141525354-141525376 AGAGGTGCATAGGGTGAGGTGGG - Intergenic
1034070958 7:148184473-148184495 AGAAGCACAGAAAGTGAGATTGG - Intronic
1034309181 7:150071883-150071905 AGAAGGCCATAGTGTGGAGTGGG + Intergenic
1036586143 8:10125521-10125543 AGAAGCACATGGACTGTGGTGGG + Intronic
1037217806 8:16479325-16479347 AGAAGCACAGATTCTGAGGAAGG - Intronic
1040874985 8:52141774-52141796 AGAAGCCCAGAGTGGGAGGCTGG + Intronic
1041785994 8:61635277-61635299 AGAATCTAATATTGTGAGGTTGG - Intronic
1042478562 8:69278242-69278264 AGAAGCAGATAGTATGAAGTTGG + Intergenic
1043560927 8:81492201-81492223 AGAAGCTCACAGTCTGAGGCCGG - Intergenic
1044757969 8:95486186-95486208 AGTAAAACAGAGTGTGAGGTGGG - Intergenic
1044969649 8:97606540-97606562 AGTAGTACCTACTGTGAGGTAGG + Intergenic
1045533566 8:103006399-103006421 AGAGGTACATAGGGTAAGGTTGG + Intergenic
1045640500 8:104245100-104245122 GAAAGCACATAGAGTGAGATAGG - Intronic
1045649827 8:104331177-104331199 AGAAGGACATAGGTTGAGGAGGG - Intronic
1046595147 8:116252477-116252499 AGAAGGAAATATTGTGAAGTCGG + Intergenic
1048778248 8:137971631-137971653 AGATGCAGATAGTATTAGGTTGG - Intergenic
1054822066 9:69532525-69532547 AGAAGCCCAGAGTGTGGGGACGG - Intronic
1056114017 9:83424332-83424354 AAAACCACATAGTGTAAGGGTGG - Intronic
1056407523 9:86289473-86289495 AGAAGGATATGGTGTGAGGAGGG - Intronic
1056860947 9:90181099-90181121 AGAAGCTCAAAGGGTGAGGGAGG + Intergenic
1060510158 9:124225856-124225878 AGAAGCCCATAGTGTTGGGCTGG + Intergenic
1061449790 9:130661759-130661781 AGAAGCACAAAATGTGAGCGCGG + Intergenic
1061743290 9:132722723-132722745 AGAAACACAGAGAGGGAGGTTGG - Intergenic
1062149856 9:135012330-135012352 AGAGGCACACAGAGAGAGGTGGG + Intergenic
1186129686 X:6453406-6453428 ACCAGCACAGAGTGTGGGGTTGG - Intergenic
1186282297 X:8006156-8006178 AGAAGCTAAGAGTGTGATGTAGG + Intergenic
1189997067 X:46649171-46649193 AGAAGCAAACAGTGTGTGTTGGG + Intronic
1190516332 X:51227257-51227279 GGAGGCATATTGTGTGAGGTGGG - Intergenic
1192543988 X:71997473-71997495 AGAAGCACATTGTGTTATGGGGG - Intergenic
1196583895 X:117407959-117407981 AGAACAACATTGTGTGATGTAGG - Intergenic
1196709467 X:118747723-118747745 AGAAGGACATTGGGAGAGGTGGG - Intronic