ID: 908741690

View in Genome Browser
Species Human (GRCh38)
Location 1:67335362-67335384
Sequence TCATTAACAGTGCTGTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908741685_908741690 14 Left 908741685 1:67335325-67335347 CCGTGATGGAAGTAGGGATGATT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 908741690 1:67335362-67335384 TCATTAACAGTGCTGTGTTAGGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908741690 Original CRISPR TCATTAACAGTGCTGTGTTA GGG Intronic