ID: 908741690

View in Genome Browser
Species Human (GRCh38)
Location 1:67335362-67335384
Sequence TCATTAACAGTGCTGTGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908741685_908741690 14 Left 908741685 1:67335325-67335347 CCGTGATGGAAGTAGGGATGATT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 908741690 1:67335362-67335384 TCATTAACAGTGCTGTGTTAGGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908741690 Original CRISPR TCATTAACAGTGCTGTGTTA GGG Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905831682 1:41074156-41074178 TCAGTAACAGTGCTCAGTGAAGG + Intronic
908741690 1:67335362-67335384 TCATTAACAGTGCTGTGTTAGGG + Intronic
910461265 1:87450230-87450252 TCTTGAAAAGTGCTGTTTTAAGG + Intergenic
910796255 1:91100409-91100431 TCAGGATCAGTGCTGTGTGAAGG + Intergenic
915774841 1:158471713-158471735 TCATGAACTGTGTTGTGTTTAGG - Intergenic
917202195 1:172529616-172529638 AAATTACCAGTGCTCTGTTAAGG + Intergenic
918676146 1:187288653-187288675 TAATTAACAGTAATGTATTATGG - Intergenic
923065059 1:230509949-230509971 TCACTGACAGTGCTGTATTTAGG + Intergenic
923628660 1:235635049-235635071 TCATTAACAATGCCATGTTCTGG - Intronic
1063167432 10:3476467-3476489 TCCTTAAAAGTGCTGTGGTTCGG - Intergenic
1064563105 10:16611993-16612015 TTATTATCAGTCCTGTTTTATGG - Intronic
1067253005 10:44604828-44604850 TCATAAATTGTGCTGTGTCAGGG + Intergenic
1068279353 10:54848693-54848715 TTATTAACAGTGGTGTGATCAGG - Intronic
1068741638 10:60480073-60480095 TAATCAACACTGCTGTGTCAGGG - Intronic
1069032660 10:63614237-63614259 TAATTAACAGTGCTCTGTGTTGG + Intronic
1070679574 10:78439214-78439236 TAATAAACAGTGCAGTGTGAGGG + Intergenic
1071617761 10:87092486-87092508 ACAGTAACAGTGCTTTGGTATGG + Intronic
1072597656 10:96889720-96889742 TCCTTAACAGTTCTTTTTTATGG + Intronic
1073733757 10:106322078-106322100 TCATTTACATTGCTGCTTTATGG - Intergenic
1073879011 10:107958434-107958456 TAATTACCAGTTATGTGTTAGGG - Intergenic
1079631281 11:22679480-22679502 ACATTAACAGTCCTGGATTATGG + Intronic
1079881949 11:25939475-25939497 TCATTAATAGTGCTGAGTTTTGG - Intergenic
1081415943 11:42816350-42816372 TCATTGACATTGTTGTGATATGG + Intergenic
1085124310 11:73988179-73988201 GCATTGTCAGTGCTGTGTTTGGG - Intergenic
1093107015 12:15099215-15099237 TCAGGAAAAGTGCTGTGTTATGG + Intergenic
1093244988 12:16725075-16725097 TCATTAACTGTTCTGACTTATGG + Intergenic
1097674583 12:62584946-62584968 TATTTTACAGTGCTGTTTTATGG + Intronic
1098098380 12:66985756-66985778 TGATTTACAGTGCTGTTTTAGGG - Intergenic
1098496804 12:71145165-71145187 CCATTAAAAGTGCTGTCTTGGGG - Intronic
1098536784 12:71602235-71602257 CTCTTAACAGTGCTGTGTCAAGG + Intergenic
1101248434 12:102907916-102907938 TCACTCAAAGTGCTGAGTTAAGG - Intronic
1106883856 13:34161266-34161288 TCATGGACAGTGCTGGTTTATGG + Intergenic
1106987136 13:35367998-35368020 TCATTAAATTTGATGTGTTATGG + Intronic
1107444126 13:40455227-40455249 TAATTAACAGTAAAGTGTTATGG + Intergenic
1109614393 13:64810877-64810899 TGATTCACAGTTCTGGGTTACGG + Intergenic
1110000398 13:70191139-70191161 TTATTAACAGTGTTTTCTTAAGG - Intergenic
1111964237 13:94845208-94845230 TCATTGACAGTGAGGCGTTAAGG + Intergenic
1114049335 14:18908820-18908842 TCATCAACAGTGTGGTTTTACGG + Intergenic
1114113228 14:19493111-19493133 TCATCAACAGTGTGGTTTTACGG - Intergenic
1115008899 14:28520844-28520866 TCATTTTCATTGCTGTATTATGG - Intergenic
1118507130 14:66425736-66425758 TTAGGAACAGTGCTATGTTAAGG - Intergenic
1118791884 14:69101409-69101431 CCATGAACAGTGCTGTAATAAGG + Intronic
1119251511 14:73159152-73159174 TTATTAACAGTGCTTTTTGAAGG + Intronic
1120040593 14:79748565-79748587 TCCTGCACAGTGCTGAGTTATGG + Intronic
1121381641 14:93475478-93475500 ACATTTACAATTCTGTGTTATGG + Intronic
1121472144 14:94164350-94164372 TCATTAAAAGTGCTGGCTTTGGG - Intronic
1127703410 15:61524334-61524356 TCTTTCTCAGTGATGTGTTAGGG - Intergenic
1131304378 15:91228597-91228619 TCATTAACAGGGCTGCAGTATGG + Intronic
1135342049 16:21657274-21657296 TTATTAAAAGTGCTGTTTTGTGG + Exonic
1137534787 16:49311867-49311889 GAATTCACAGTGCTGAGTTATGG - Intergenic
1146893149 17:36521645-36521667 AAATTCACAGTGCTGTGTTGTGG - Intronic
1153518559 18:5929729-5929751 CCATCAACTGTGCTGTGTGAGGG - Intergenic
1156056475 18:33010887-33010909 TAAATCAGAGTGCTGTGTTAAGG + Intronic
1158251575 18:55494125-55494147 TCAATCACATTGCTGTGTTTTGG - Intronic
1167218280 19:48179909-48179931 ACATTGGCAGTGCTGTGTTCTGG + Intronic
1168523297 19:57069477-57069499 TCGTTAACAGTGTTGTGCAATGG + Intergenic
925364046 2:3299040-3299062 TCATTAATAGTGCTATGGTGGGG - Intronic
925505961 2:4564355-4564377 TTATTAACCATGCTGTTTTAAGG + Intergenic
926110064 2:10176692-10176714 TCTTTATAATTGCTGTGTTAAGG + Intronic
927335646 2:21920728-21920750 ACCTTAACAGTTCTGTGTGATGG - Intergenic
927587927 2:24325725-24325747 TCAATATCAGTGATGAGTTAGGG - Intronic
928032457 2:27793272-27793294 GCATTAACACTGCTGGGTAAAGG + Intronic
929427981 2:41863461-41863483 TCTTGAAAAATGCTGTGTTAGGG - Intergenic
933017532 2:77148056-77148078 TCAATAACAGTGATGTTTTTTGG + Intronic
934137687 2:89013088-89013110 CCATTTATAGTGCTGTGTTTTGG - Intergenic
934231561 2:90187540-90187562 CCATTTATAGTGCTGTGTTTTGG + Intergenic
937442619 2:121929819-121929841 CCCTTCACAGTGCTGTGGTAAGG + Intergenic
938426676 2:131197154-131197176 TCATCAACAGTGTGGTTTTAAGG + Intronic
940123349 2:150293768-150293790 TCAGTAACAGTGCTATTATATGG + Intergenic
941681179 2:168401277-168401299 TCAGTAAAAGTGCTCTGGTAGGG + Intergenic
942938974 2:181594021-181594043 ACAATAAAAGTGCTGTGATAAGG + Intronic
943119283 2:183713933-183713955 TGATTATCATTGCTTTGTTATGG + Intergenic
943456267 2:188111323-188111345 TCCTTAACAGTGGTGTGTGAAGG - Intergenic
943708731 2:191064907-191064929 TCATTAACAGGTCTGTCTCATGG + Exonic
945128677 2:206542216-206542238 TCCGTGCCAGTGCTGTGTTAGGG + Intronic
945996100 2:216437502-216437524 TGAGTAACAGGGCTGTGCTAAGG + Intronic
948155865 2:235780557-235780579 TAATTTACAGTGCTGTGGCAAGG + Intronic
1169882460 20:10361923-10361945 TTCTTAACTGTGCTGTTTTATGG + Intergenic
1171174402 20:23040675-23040697 TCATTTCAAGTGCTATGTTACGG - Intergenic
1175019233 20:55826646-55826668 CCATTAACAGTGCAGTGGAAAGG - Intergenic
1177652589 21:23977741-23977763 TCATTAACAGTAATGTGTTCAGG - Intergenic
1178054730 21:28785408-28785430 GCAGTAAAAATGCTGTGTTAAGG - Intergenic
1178451584 21:32706352-32706374 AAATTAACAGTGATGTATTATGG - Intronic
1179338999 21:40486660-40486682 GCTTAAACAGTGCTGTATTAAGG - Intronic
1180467818 22:15631195-15631217 TCATCAACAGTGTGGTTTTACGG + Intergenic
1181111516 22:20605562-20605584 GCCTTAACTGTGCAGTGTTATGG + Intergenic
1182109074 22:27710204-27710226 TGCTGAACAGTGCTGTGTTGGGG + Intergenic
1183924371 22:41195716-41195738 TAATTAAAAGTGCTGTGCCAGGG + Intergenic
949114121 3:298953-298975 GTATTAACAATGCCGTGTTAAGG + Intronic
950157485 3:10733942-10733964 CTCTTAACACTGCTGTGTTAGGG - Intergenic
952814396 3:37434678-37434700 CTATTAACATTGCTGTGTAATGG - Intronic
958483911 3:94678911-94678933 ATATTGACAGTGGTGTGTTAAGG - Intergenic
964197544 3:154082047-154082069 TCTTTAGCACTGCTGGGTTAGGG - Intergenic
967598464 3:191356186-191356208 TCATGTAAAGTGCTGTTTTAAGG - Intronic
971796972 4:31240724-31240746 GCATTGACAGTGCTCTGATATGG + Intergenic
972637467 4:40896930-40896952 ACAGTAACATTGCTGTCTTAGGG - Intronic
973618716 4:52706406-52706428 TCCTTAGCTGTGCTGTGCTAAGG + Intergenic
974004929 4:56546164-56546186 TCATTTATAGTGCTGTGTTTTGG + Intronic
979363772 4:119796022-119796044 TCATCAAAAGTGCTATGTTTGGG - Intergenic
979403317 4:120277954-120277976 GCATTAACAGGGCTTTGTTAGGG - Intergenic
980433842 4:132742773-132742795 TCTTTGACAGTGCAGTGTTGAGG + Intergenic
983426369 4:167588885-167588907 TCTTTAACAGTGTCTTGTTACGG - Intergenic
986790354 5:11153527-11153549 TCATTAACATTACTTTGTGAAGG + Intronic
987594895 5:19985186-19985208 TCTTCCACAGTACTGTGTTAGGG + Intronic
987748942 5:22014309-22014331 ACATAAACAGTGCAGTGTTATGG - Intronic
990494846 5:56337169-56337191 TCATGAAAAGTGCCCTGTTATGG + Intergenic
991131147 5:63123551-63123573 CCATTTGCAGTGCTTTGTTATGG - Intergenic
991462414 5:66872845-66872867 TCATGATCAGTGGTGTTTTAAGG + Intronic
991769126 5:70024077-70024099 ACATAAACAGTGCAGTGTTATGG - Intergenic
991848421 5:70899495-70899517 ACATAAACAGTGCAGTGTTATGG - Intergenic
994661865 5:102663394-102663416 TCATTAACAGTCGTGTGTCATGG + Intergenic
999444505 5:151628440-151628462 TCATTAACCTTGCTTTGTTCTGG - Intergenic
1003389941 6:5705077-5705099 AAAATAACAGTGCTTTGTTACGG + Intronic
1004086881 6:12458403-12458425 TCATTAAAAGTGCTGGGCTAAGG + Intergenic
1006346955 6:33490385-33490407 TCTTTAACAGTGCTTTGATAGGG - Intergenic
1008404051 6:51099394-51099416 TCATTAACCATGGTGAGTTATGG - Intergenic
1010510881 6:76717788-76717810 TAATAAAAATTGCTGTGTTATGG - Intergenic
1011317001 6:86045262-86045284 TCATTAACAGTACTGAGTCTGGG - Intergenic
1012140149 6:95616505-95616527 TGCTTAGCAGTGCTGTGGTAGGG - Intergenic
1012522345 6:100136478-100136500 TCATTAACAGTGATCTGGAAAGG - Intergenic
1012589667 6:100965474-100965496 TAATTAGCAGTTCTGTGTTTTGG - Intergenic
1016603537 6:145891042-145891064 TCATTCTGAGTGCTGTGATAGGG - Intronic
1016739378 6:147511144-147511166 TCAGGAAAAGTGCTGTGTAATGG + Intronic
1019228515 6:170536409-170536431 TCACTAATAGTGCTTTGTTTGGG - Intronic
1022956390 7:35385409-35385431 TCATTAACAGTGCTTGGAGATGG + Intergenic
1024856490 7:53786514-53786536 TCATTATCAGTAATGTGATAAGG + Intergenic
1026364565 7:69634783-69634805 TTTCTAATAGTGCTGTGTTAGGG + Intronic
1027552141 7:79612450-79612472 TCATCAAAAGTTGTGTGTTATGG + Intergenic
1028058448 7:86278189-86278211 TCTTTAATAGGGCTATGTTATGG + Intergenic
1030683148 7:112453487-112453509 TCATTAATACTGATGAGTTAAGG + Intronic
1032374657 7:131399752-131399774 TCATTAACAGTGTAGTTTTGAGG + Intronic
1033682871 7:143613105-143613127 TCATTAACATTTCTGTCTGAAGG + Intergenic
1033701740 7:143844537-143844559 TCATTAACATTTCTGTCTGAAGG - Intergenic
1034795733 7:154011175-154011197 TCAGGAACAGAGCTGGGTTAAGG - Intronic
1044772635 8:95653181-95653203 TCAATAACATTGCTGTATTCTGG - Intergenic
1045387626 8:101686826-101686848 TCATTGTCATTGCTGTGTTCAGG - Exonic
1046000448 8:108414599-108414621 TCATTAATAATCCTGAGTTAAGG + Intronic
1046350388 8:113001987-113002009 TCATTAAGAGTGGTCTCTTAAGG + Intronic
1047362145 8:124178926-124178948 TCATGCACAGTGCTGTGCTCAGG - Intergenic
1047810463 8:128403402-128403424 TTATGACAAGTGCTGTGTTAAGG + Intergenic
1047881197 8:129195682-129195704 TCATTTATAGTACTATGTTATGG + Intergenic
1048414161 8:134207851-134207873 TCATGGACAGTGCAGTTTTAGGG - Intergenic
1049882417 8:145075415-145075437 TCAGCAGCTGTGCTGTGTTATGG + Intergenic
1053572451 9:39323510-39323532 TAATTAACAGGACAGTGTTAAGG - Intergenic
1053623835 9:39848041-39848063 TCATTAACAGGACAGTGTTAAGG - Intergenic
1053881033 9:42595188-42595210 TCATTAACAGGACAGTGTTAAGG + Intergenic
1053891637 9:42699130-42699152 TAATTAACAGGACAGTGTTAAGG - Intergenic
1054094011 9:60882222-60882244 TAATTAACAGGACAGTGTTAAGG - Intergenic
1054115485 9:61158139-61158161 TAATTAACAGGACAGTGTTAAGG - Intergenic
1054124694 9:61295501-61295523 TAATTAACAGGACAGTGTTAAGG + Intergenic
1054220062 9:62402659-62402681 TCATTAACAGGACAGTGTTAAGG + Intergenic
1054230653 9:62506513-62506535 TCATTAACAGGACAGTGTTAAGG - Intergenic
1054592271 9:67024403-67024425 TAATTAACAGGACAGTGTTAAGG + Intergenic
1056015232 9:82378418-82378440 TAATTGACAGTGAGGTGTTAAGG - Intergenic
1058576992 9:106414414-106414436 TGATGCACAGTGCTGTTTTATGG + Intergenic
1059193567 9:112349498-112349520 TCTCAAACAGGGCTGTGTTATGG + Intergenic
1060078707 9:120619941-120619963 TTTTCAACAGTGCTGTGATAAGG - Intronic
1186240881 X:7564937-7564959 TCATTAACAGTGCTGGGAGTTGG - Intergenic
1187432560 X:19238341-19238363 TCGTTATCATTGCAGTGTTACGG + Intergenic
1187434627 X:19256049-19256071 TCATATACAGTGCTATTTTAAGG - Intergenic
1187790187 X:22942116-22942138 TCATTAAGAGTGATTTGTTATGG + Intergenic
1189452858 X:41155644-41155666 TCACCAACAGTGCTATGTTAGGG + Intronic
1189829803 X:44960299-44960321 TTATTAACAGAGCAATGTTACGG + Intronic
1194227705 X:91281355-91281377 TTATTAACTGTGTTGTGTTTTGG - Intergenic
1195933425 X:110102582-110102604 TCATTTACATTGATCTGTTAAGG + Intronic
1200002204 X:153067856-153067878 CCCTTAACACTGCTGCGTTAGGG - Intergenic
1200005529 X:153082169-153082191 CCCTTAACACTGCTGCGTTAGGG + Intergenic
1201576701 Y:15468856-15468878 TAATTAATCGTGCTGTCTTAAGG + Intergenic