ID: 908742368

View in Genome Browser
Species Human (GRCh38)
Location 1:67342034-67342056
Sequence TGCCACTCTCAGGCAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908742358_908742368 12 Left 908742358 1:67341999-67342021 CCACTCTTATCCCAGCCTCTAAT 0: 1
1: 0
2: 4
3: 30
4: 263
Right 908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 31
4: 206
908742361_908742368 2 Left 908742361 1:67342009-67342031 CCCAGCCTCTAATAGGGATTCCT No data
Right 908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 31
4: 206
908742363_908742368 -3 Left 908742363 1:67342014-67342036 CCTCTAATAGGGATTCCTCATGC No data
Right 908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 31
4: 206
908742362_908742368 1 Left 908742362 1:67342010-67342032 CCAGCCTCTAATAGGGATTCCTC 0: 1
1: 0
2: 0
3: 4
4: 98
Right 908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG 0: 1
1: 0
2: 0
3: 31
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908742368 Original CRISPR TGCCACTCTCAGGCAGGCTT GGG Intronic
900505973 1:3029899-3029921 TGCCACACTAGGGGAGGCTTGGG + Intergenic
900522832 1:3113833-3113855 TGCCTCCCTCAGGCCGGCTCTGG + Intronic
901808129 1:11750483-11750505 TGCAACACTCAGGCAGGACTCGG - Exonic
902663215 1:17919982-17920004 TGCCAGGCTCTGGCAGGCTTTGG + Intergenic
903483423 1:23671163-23671185 TGCCCATCTCAGGCTGGCATGGG + Intergenic
903592276 1:24466161-24466183 TGGCACTCTCAGCCAGGCCTTGG + Intronic
903658202 1:24961600-24961622 TGTGCCTCTCAGGCAGGCTTGGG - Intronic
904818250 1:33221303-33221325 GGCCCCCATCAGGCAGGCTTGGG + Intergenic
905311338 1:37051286-37051308 TGCCACCCTCACCCAGGCATTGG + Intergenic
905517088 1:38569859-38569881 TGCCAGTCTCAGGATGGCTCAGG - Intergenic
906132767 1:43470868-43470890 GGCCATTCTGAGGAAGGCTTTGG + Intergenic
906697886 1:47837008-47837030 AGCCACTCTATGACAGGCTTTGG - Intronic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
909823290 1:80093211-80093233 GGACACTTACAGGCAGGCTTTGG - Intergenic
910405226 1:86881981-86882003 TGCCGCTCTTAGGGAGGCTGAGG + Intronic
911158845 1:94662693-94662715 TGTCACTTTCTGGCAGGCCTAGG - Intergenic
911301449 1:96179493-96179515 TGAAAGTGTCAGGCAGGCTTGGG + Intergenic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
915491407 1:156251944-156251966 TGCCCCTCCCTGGCTGGCTTCGG + Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
920114884 1:203613449-203613471 CCCCACTCTCAGACAGGCATTGG + Intergenic
920377067 1:205514522-205514544 TTCCACTTTCAGGCAGGCCAGGG - Intronic
920850825 1:209626944-209626966 TGCCCCTGTCGGGAAGGCTTTGG - Exonic
922267958 1:224004727-224004749 TCCCACCTTCAGGCAGGTTTGGG + Intergenic
923469729 1:234279756-234279778 CTCCACTGTGAGGCAGGCTTTGG - Intronic
1066725744 10:38390882-38390904 TCCCACCTTCAGGCAGGATTGGG - Intergenic
1067777636 10:49174965-49174987 TGACACTCCCAGGCTGGGTTAGG - Intronic
1069554285 10:69387014-69387036 TGGCACTCTCAGTTAGGCCTTGG + Intronic
1069779834 10:70948325-70948347 TGCCACTCTAAGGATGGCTCAGG + Intergenic
1069794734 10:71044733-71044755 TGCTCATCTCAGGCAGGCTAGGG - Intergenic
1070674879 10:78405699-78405721 GGCCAGTCTCAGGCAGGGGTTGG - Intergenic
1073437576 10:103529396-103529418 TGTCATTTTCTGGCAGGCTTAGG - Intronic
1075809000 10:125210673-125210695 TGCTTCTTTCAGGCAGGCCTGGG + Intergenic
1076300456 10:129421652-129421674 TCACACTCTCAGGCCGCCTTTGG + Intergenic
1076757001 10:132577723-132577745 TGCCTGTCTCAGGGAGGCATTGG + Intronic
1077370163 11:2178008-2178030 TGCCAGACTCAGGCTGGCTCAGG - Intergenic
1077370245 11:2178320-2178342 TGCCAGACTCAGGCTGGCTCAGG + Intergenic
1077543018 11:3156491-3156513 TCACACTCCCAGGCGGGCTTTGG - Intronic
1077671003 11:4157475-4157497 TGTCACTCCCAGTCAGGCTTGGG - Intergenic
1078198521 11:9157487-9157509 CTCCACTCTCAAGCAGGCCTTGG + Intronic
1078447795 11:11417612-11417634 TGCCCCTCTCAGGAGGGCTTGGG + Intronic
1082737317 11:56871264-56871286 TGCCACTTTCTGACAGGCTCAGG + Intergenic
1083358866 11:62091044-62091066 TGTCACTTTCTGACAGGCTTAGG + Intergenic
1083553532 11:63608368-63608390 TGCCACTTTCAGGCTGCCCTGGG - Intronic
1083894063 11:65611462-65611484 TGCCAGGCTCAGGGAGGCTGAGG + Intronic
1085025369 11:73233359-73233381 TCCCACTCTCTGGGAGGCTCTGG - Intronic
1085195900 11:74671564-74671586 TGCCACTCCCACACAGGCTGTGG - Intergenic
1089466220 11:118688175-118688197 TGCCTCTCCCAGGAGGGCTTTGG - Intergenic
1090071463 11:123548000-123548022 TGCCTACCTCAGGCAGGCTCCGG + Intronic
1090492816 11:127180097-127180119 TCCAAGTCTCAGGAAGGCTTGGG - Intergenic
1090849852 11:130562426-130562448 CGACACTTTCAGGCAGGCCTGGG + Intergenic
1091385053 12:88557-88579 TTCCATCCTCTGGCAGGCTTGGG + Intronic
1092981258 12:13796716-13796738 TGCCATTCCCCTGCAGGCTTGGG + Intronic
1093708427 12:22301787-22301809 TGTCACTTTCTGGCAGGCTCAGG + Intronic
1094727390 12:33134098-33134120 TGCCACTTTCTGGCATGTTTAGG - Intergenic
1096921766 12:55095055-55095077 TGTGACTCTCAGGCAGACTCTGG - Intergenic
1097701343 12:62823416-62823438 TGTCTCTCTCTGCCAGGCTTTGG - Intronic
1100340542 12:93675314-93675336 CACCACTCTCAGGCAGGTTTTGG + Intergenic
1101805803 12:108062453-108062475 TCCCACTCTCAGGCCGATTTTGG - Intergenic
1101990080 12:109477288-109477310 TGCCTCTCTCAGTCCGGGTTTGG - Exonic
1103380664 12:120491687-120491709 TGTTACTCACAGGCAGGCTGAGG - Intronic
1104752082 12:131246143-131246165 TGCCATTCTCAGACACGCCTGGG + Intergenic
1104798175 12:131534258-131534280 TGCCAGTTTCAGGCAAGCTGAGG - Intergenic
1104948707 12:132429130-132429152 TGGGACTCGCAGGCAGGTTTCGG - Intergenic
1105541575 13:21321022-21321044 TGCCAAACTCAGGCAGGCCAGGG - Intergenic
1108596950 13:51957657-51957679 TGTGACTCTCAGGCTGGGTTTGG - Intronic
1108641426 13:52385943-52385965 GGTAACTCTCAGGCAGGCCTGGG + Intronic
1110606624 13:77440301-77440323 TGCCTGTCTCTGCCAGGCTTTGG + Intergenic
1113860927 13:113486335-113486357 TGCCACCCTCAAGCAGGCCCTGG - Intronic
1114982685 14:28185931-28185953 TGCCACTTTCTGACAGGCTCAGG + Intergenic
1117650509 14:57900035-57900057 AGCCAATCGCAGGGAGGCTTGGG - Intronic
1119166768 14:72501088-72501110 TGCCAATCTCAGGTGGGCTTTGG + Intronic
1119946313 14:78698590-78698612 TCCCACTCTGAGGCACGCTAAGG - Intronic
1121719116 14:96097039-96097061 TGTCACCCTCATGCAGACTTTGG - Intergenic
1122059759 14:99129215-99129237 TGCACCTCTCGAGCAGGCTTCGG - Intergenic
1122175438 14:99914643-99914665 TGCCACTCTCTGGGACGCTGTGG + Exonic
1122890235 14:104728880-104728902 TTCAGCTCTCATGCAGGCTTGGG - Intronic
1127722916 15:61720359-61720381 TCCCACACTCAAGCAGGCCTTGG + Intergenic
1128160225 15:65418733-65418755 TGTCATTACCAGGCAGGCTTGGG - Intronic
1129009133 15:72398896-72398918 TGGCACTCACAGGGTGGCTTGGG - Exonic
1129272007 15:74423907-74423929 GGCAACTCTCAGGCAGGGTTAGG + Intronic
1130514796 15:84617999-84618021 TGCCCCTCTCAGGCAGGACCTGG - Intronic
1130878126 15:88032003-88032025 TCCAGCTCTCAGGCAGGCATGGG + Intronic
1131602565 15:93864187-93864209 CTCCACCCTCAAGCAGGCTTTGG + Intergenic
1132414903 15:101612953-101612975 TGCCACCAGCAGCCAGGCTTGGG - Intergenic
1132826945 16:1909866-1909888 GGCCAGACTCAGGCAGGCTGGGG - Intergenic
1132995483 16:2820356-2820378 TGGCACTCTGAGGCAGGAATTGG + Intronic
1134319562 16:13150343-13150365 TGACACCCCCAGGCAGACTTGGG + Intronic
1135984311 16:27172886-27172908 TGTCACTGTCAGCCAGGCTGGGG - Intergenic
1136113615 16:28080550-28080572 TGCTACTATCAGCCAGGCTTGGG - Intergenic
1138121696 16:54405501-54405523 TGCAACTCTCAGGCAGGCAGTGG + Intergenic
1140291443 16:73662558-73662580 TGCCAGCCTCAGGAAGGCTGTGG - Intergenic
1140471737 16:75219098-75219120 TCCCCCTCTCAGCCAGGCTCAGG - Intronic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1141893794 16:86945520-86945542 TGCCTCTCCCAAGGAGGCTTGGG - Intergenic
1143101768 17:4508442-4508464 TGGGATTCTCAGGCAGGTTTGGG + Intronic
1145817811 17:27808095-27808117 GGCCACTGTCAGGCAGACTCAGG + Intronic
1146017234 17:29243746-29243768 ATCCACTCTTAGGCTGGCTTAGG - Intergenic
1148339359 17:46864105-46864127 TCCCACGCACAGGCAGGCTCAGG - Intronic
1148835319 17:50462906-50462928 TGCCACCCACAAGCTGGCTTGGG - Intronic
1148956283 17:51356197-51356219 TGCCTCCCTCAGGCAGGGTAGGG + Intergenic
1149337655 17:55653262-55653284 TGGCACACTCAGGCATGCTGAGG + Intergenic
1150264297 17:63821930-63821952 TGCCACTCTGAGGAAGTGTTAGG - Intronic
1152648653 17:81481912-81481934 TGCCCCTCTCAGGCAAGATCGGG - Intergenic
1154029287 18:10737436-10737458 TGCCATTCTCAGTCTGTCTTAGG - Intronic
1154066440 18:11111159-11111181 TGACACTCCCAGGCTGGCTGTGG - Intronic
1154411160 18:14142988-14143010 TCCAACTCTCAGTCAGGGTTTGG + Intergenic
1157491074 18:48124238-48124260 TGCAACCCTCAGGCAAGCCTGGG + Intronic
1160022057 18:75188776-75188798 TGCCACTCTCACCCAAGCCTTGG - Intergenic
1162362326 19:10227549-10227571 AGCCAGTCCCAGGCAGGCTTGGG + Intronic
1163059442 19:14748134-14748156 CTCCACCCTCAAGCAGGCTTCGG + Intronic
1164191202 19:22918793-22918815 TGTCTCTCTCAGCGAGGCTTAGG + Intergenic
1164509292 19:28884420-28884442 TTCCACCCTCAAGCAGGCCTCGG + Intergenic
1164853230 19:31501579-31501601 GGTCACTCTCTGGCAGCCTTGGG - Intergenic
1168042896 19:53773043-53773065 TCCCACCTTCAGGCAGGATTGGG - Intergenic
1168245194 19:55109654-55109676 AGCCACTCACAGGCAGGGCTGGG - Intronic
926065444 2:9836131-9836153 TGACCCTCTCAGGAAGGATTAGG - Intergenic
928549251 2:32355695-32355717 TGTCACTCTCTGGCAGGCCCAGG + Intergenic
929529970 2:42743871-42743893 TGGCACTCCTAGGCATGCTTAGG + Intronic
929752367 2:44729072-44729094 TTCCACTCTCATTCAGGCTGGGG - Intronic
930110121 2:47671780-47671802 TGCCACTTTCTGACAGGCCTAGG - Intergenic
932702737 2:74002507-74002529 TGCCGCTCCCCGGCAGGCTGGGG - Intronic
932772532 2:74508380-74508402 TGCCACACACAGACAGGCTTAGG + Exonic
933253750 2:80057580-80057602 TCCCACTCACAGGCAGTCCTCGG + Intronic
934855661 2:97727919-97727941 TGCCACTCTCAGGAGGCTTTAGG - Intronic
937009194 2:118546474-118546496 TGCCAATCATATGCAGGCTTAGG + Intergenic
939090227 2:137771624-137771646 AGCCACTCTCAGGAAGACTTTGG - Intergenic
941917628 2:170822782-170822804 TGCCTCCCTCAGGCAGGCCATGG - Intronic
946247310 2:218395043-218395065 TGCCACTCCCAGCCAGGCCCTGG - Exonic
946701135 2:222415322-222415344 TGTCACTTTCTGACAGGCTTAGG + Intergenic
947937161 2:234017230-234017252 TTCCATTCTCAGGCAGGATATGG - Intronic
948576744 2:238956531-238956553 TGGCACTGACAGGCATGCTTTGG + Intergenic
948751411 2:240135514-240135536 TGCCACTCTGAGCTAGGCTGTGG + Intronic
948902922 2:240965255-240965277 GGCCACACTTAGGGAGGCTTGGG - Intronic
1170879754 20:20286247-20286269 CGCCACTATCAGGCAGGATGTGG - Intronic
1171190831 20:23158155-23158177 TCCCATTCTCAGGCAGCCCTGGG + Intergenic
1173340493 20:42148636-42148658 TGGCACTCACAGGTAGGCCTTGG + Intronic
1174152347 20:48494243-48494265 TGTCACTCCCAGGTAGGCTGGGG - Intergenic
1174640088 20:52036260-52036282 AGCCACTGGCAGGCAGGCATGGG + Intergenic
1176861896 21:14015427-14015449 TCCAACTCTCAGTCAGGGTTTGG - Intergenic
1177416778 21:20803638-20803660 TAAAACTCTCAGGCAAGCTTTGG - Intergenic
1178742250 21:35212777-35212799 AGTCATTCTCAGACAGGCTTGGG + Intronic
1180177264 21:46096944-46096966 TGCCACACTCAGGCACACTTAGG + Intergenic
1180259561 21:46659646-46659668 TGCCACTGCCAGGCAAGCCTGGG - Intronic
1182818316 22:33188996-33189018 GGGCACTCTCAGCCAGGGTTGGG + Intronic
1184512713 22:44942750-44942772 TGCCACTCCCAGGGAAGCCTGGG - Intronic
1184649554 22:45913345-45913367 AGCCGCTCTCAGACAGGCTCTGG - Intergenic
1184729422 22:46364674-46364696 TGTCACTCTCAGCCAGGCTCTGG + Exonic
1185148191 22:49150457-49150479 TGCCCCACTCAGGGAGGGTTGGG + Intergenic
1185367059 22:50441603-50441625 TCCAACTCTCAGTCAGGATTTGG - Intronic
949878240 3:8641133-8641155 AGCCGCACTCAGGCAGGCTTTGG - Intronic
952338824 3:32428205-32428227 AGCACCTCTCAGGCAGGCTTTGG - Intronic
953902886 3:46853104-46853126 TGGCACTCCTAGGCAGGCTGTGG - Intergenic
953994715 3:47510952-47510974 TGCCACTCTTTGGCAGGGCTGGG + Intronic
954101920 3:48380272-48380294 TATCACTCTGAGGAAGGCTTTGG + Intronic
954651346 3:52165432-52165454 TGCCATTTTCTGACAGGCTTAGG + Intergenic
956890846 3:73612871-73612893 TGCCATACTGAGGCAGTCTTTGG - Intronic
958981643 3:100727166-100727188 TGGCACTCACAGGTAGGCTGTGG - Intronic
963130924 3:141856899-141856921 TGCCGCTCTCAGGCAGACTGTGG + Intergenic
965103225 3:164329360-164329382 TGTCACTTTCTGGCAGGCCTAGG - Intergenic
966332622 3:178831735-178831757 CTCCACACTCAAGCAGGCTTTGG - Intronic
967424060 3:189305857-189305879 TGCCTCTTTCTGGGAGGCTTTGG + Intronic
968281887 3:197483551-197483573 AGCCACTTTCAGCCAGGCTAAGG - Intergenic
969694430 4:8726546-8726568 TGCCAGGCTCAGGCTGGCTGGGG + Intergenic
970120329 4:12746270-12746292 TTCCTCTCTCCTGCAGGCTTTGG + Intergenic
972447337 4:39157757-39157779 TGGCACTCACTGGTAGGCTTTGG - Intergenic
973735867 4:53871147-53871169 TGCTACTCTAAGGCAGCCTTGGG - Intronic
976497067 4:85742137-85742159 TGCCACTGTTTGGCAGGATTTGG + Intronic
979335942 4:119462916-119462938 TCCCACCTTCAGGCAGGATTGGG + Intergenic
979494746 4:121370598-121370620 TGCCACTCTCACCATGGCTTGGG - Intronic
983268017 4:165528133-165528155 ATCCACTCTCAGGTAGGCATTGG + Intergenic
985264145 4:188142693-188142715 AGCCACTCTCAGGCTTGTTTGGG - Intronic
985472201 5:53390-53412 TCCCCTTCTCAGGCAGGCTGTGG + Intergenic
985639723 5:1058020-1058042 TCCCCGTCTCAGGGAGGCTTGGG + Intronic
986032070 5:3904406-3904428 CTCTACTCTCAGGCAAGCTTAGG - Intergenic
986687709 5:10288873-10288895 TGCCCCTCTCAGCCAGCCTGGGG + Intronic
988006288 5:25416062-25416084 TGCCATTTTCAGACTGGCTTAGG + Intergenic
988216505 5:28281282-28281304 TGCCACTTTCAGGCTGGCGAAGG - Intergenic
989013460 5:36901099-36901121 TCCCACCCTCAAGTAGGCTTTGG + Intronic
989639814 5:43572494-43572516 TGTCACTCTCTGGCAGGCCCAGG - Intergenic
996117032 5:119630684-119630706 TGCCAGTCTCAGGCAGGCGGGGG + Intronic
996222221 5:120948348-120948370 TGTCACTTTCTGGCAGGCTCAGG - Intergenic
997454734 5:134008049-134008071 GGCCACTCCCAGGAAGGCTTTGG - Intergenic
998169605 5:139864796-139864818 TGGTACCCTCAGGCAGCCTTCGG + Intronic
998389746 5:141779849-141779871 ACCCACTCTCTGGCAGGATTTGG + Intergenic
999425469 5:151484443-151484465 TGCCACCCTCAGGCAGGACGTGG + Intronic
1001351576 5:170972432-170972454 TGCAACACTCAGGGAGGCTAAGG - Intronic
1001525423 5:172425374-172425396 TACCACCCTCATGCAGACTTCGG - Intronic
1002292783 5:178211159-178211181 TCCCACACTCACCCAGGCTTGGG - Exonic
1003046803 6:2740645-2740667 AGCCACCCTCACGCATGCTTGGG + Intronic
1003340492 6:5215466-5215488 TGCCACACTCAGACAGGCCTAGG - Intronic
1005768318 6:29037382-29037404 TGCCACCCTCAGGTAGGCCCAGG + Intergenic
1006358460 6:33574198-33574220 TGCCACTCTCAAACAGGCTGTGG + Exonic
1006445454 6:34077309-34077331 GGCCCCTCTCAGGCTGGCTCTGG + Intronic
1007250296 6:40490666-40490688 TGCCCCTCACAGCCAGGCCTGGG + Intronic
1008456144 6:51713350-51713372 TTCCAGCCTGAGGCAGGCTTGGG - Intronic
1011618033 6:89215900-89215922 TGCCACTCTAACTCTGGCTTGGG + Intronic
1011764440 6:90604914-90604936 TTCCACCCACAGTCAGGCTTGGG - Intergenic
1014079833 6:117273059-117273081 TGCCACTCACATTCAGGCTGAGG - Exonic
1014905480 6:127021748-127021770 TGAAACTCTCAGCCATGCTTAGG + Intergenic
1015502834 6:133952079-133952101 TCCCACTCTCAGGCCGGCATCGG - Intergenic
1016301606 6:142637799-142637821 TGCCCTTCTCTGGCAGGGTTAGG - Intergenic
1016846175 6:148570650-148570672 TGCCTCTCTCAGGCTGGCAGAGG - Intergenic
1017766302 6:157609899-157609921 TGCTACTTTAAGGCAGGCCTGGG - Intronic
1017993436 6:159510144-159510166 GGCCACCCTCAGGTAGGCGTTGG + Intergenic
1019287938 7:232935-232957 GGCCCCTCTCAGGAAGGCTGGGG - Intronic
1024067861 7:45756950-45756972 TCCCACCTTCAGGCAGGATTGGG - Intergenic
1024242903 7:47449019-47449041 TGTTAGTCTCAGGCAGGCATTGG - Intronic
1024633887 7:51271050-51271072 TGCTACTCCCAGGAATGCTTGGG + Intronic
1027952773 7:84839046-84839068 TGACCTTCTCAGTCAGGCTTAGG - Intergenic
1028428166 7:90714396-90714418 TGCATCTCTCAGGCAGGATTTGG + Intronic
1030673702 7:112364044-112364066 TGCCACTCACAGACAGGGGTGGG + Intergenic
1031994669 7:128222051-128222073 TGAGAATCTCAGGCAGGGTTAGG - Intergenic
1032487645 7:132300037-132300059 TCCCAATGTCAGGCAGGCTTTGG - Intronic
1036731837 8:11272396-11272418 TGCCCTTCTCAGGGAGCCTTCGG - Intergenic
1039993347 8:42508679-42508701 TGCCACTCCCAGGCCGGGTGTGG - Intronic
1041313940 8:56542584-56542606 TGCCAGGCTCAGGCTTGCTTGGG + Intergenic
1041969987 8:63729499-63729521 CACCACTCCCAGGCAGGCTGAGG + Intergenic
1042703983 8:71647383-71647405 TTCCACCCTCAGGCAGGCCCTGG - Intergenic
1043991222 8:86757453-86757475 TGGCACTCTCCAGCTGGCTTGGG + Intergenic
1045225641 8:100242702-100242724 ACCCTCTCTCAGGCAGGCCTGGG - Intronic
1050932630 9:11349338-11349360 TGCCACTGTCTGTCAGGCTGTGG - Intergenic
1052645307 9:31226981-31227003 TGTCTCTCTCTGCCAGGCTTTGG + Intergenic
1052939429 9:34120722-34120744 TGATACTCTCAGGTAGGCCTTGG + Intronic
1053287535 9:36859552-36859574 TCCCACTCTCAGTCAGCCTTGGG - Intronic
1056256428 9:84803722-84803744 TCCCACTCTCAGGCAGAGTTGGG + Intronic
1060325117 9:122606978-122607000 TGTCATTCCCAGGCATGCTTGGG + Intergenic
1060518977 9:124283171-124283193 TGACCCTCTCAGGAAGGCTGGGG + Intronic
1061101049 9:128492611-128492633 GGCCACTCCCAGGGAGGGTTGGG + Intronic
1061890105 9:133614826-133614848 TGCCATTGTTAGGCAGGCTTTGG - Intergenic
1062572415 9:137191762-137191784 GGCCACTGTGAGGCAGGCTGAGG + Exonic
1062587696 9:137256791-137256813 TGCCACTCACAGGCAGCCTGTGG + Intronic
1185845849 X:3437368-3437390 AGACACTCTCAGACATGCTTGGG - Intergenic
1187274455 X:17805761-17805783 GGCTACTCTCAGGCCTGCTTTGG - Intronic
1190452294 X:50594141-50594163 TGCTACTCACTGGCAGGCCTTGG + Exonic
1197365608 X:125561976-125561998 TGCCACTGTCACTCAGGCTCTGG + Intergenic
1199529429 X:148830251-148830273 AGGCCCCCTCAGGCAGGCTTCGG - Intronic
1199585116 X:149406518-149406540 AGCCACTCTCTGGGAGGCTGTGG - Intergenic