ID: 908742450

View in Genome Browser
Species Human (GRCh38)
Location 1:67342627-67342649
Sequence GTGTGAGGATGTGAGGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 909
Summary {0: 1, 1: 1, 2: 11, 3: 92, 4: 804}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908742450 Original CRISPR GTGTGAGGATGTGAGGATGT TGG Intronic
900588058 1:3443074-3443096 GGGTGAGGACGTGTGGATGCAGG - Intergenic
900610038 1:3540818-3540840 GTGTGATGGTGTGAAGAGGTGGG - Intronic
900978563 1:6033219-6033241 GTGTGCGCATGTGTGCATGTGGG + Intronic
901205502 1:7493414-7493436 GTGTGTGCATGTGTGTATGTAGG - Intronic
901372432 1:8811199-8811221 GTGTGAGCAGATGAGCATGTGGG - Intronic
901465234 1:9417128-9417150 GTGTGAGCATGTGAAGATGGAGG - Intergenic
901856391 1:12046922-12046944 GTGTGACGGTGTGTGGGTGTGGG - Intergenic
902538574 1:17136306-17136328 GTGTGAGGATGGGTGGATGCAGG - Intergenic
902946609 1:19845219-19845241 GTGAGAGGATGAGAGGGTGAGGG + Intergenic
903026446 1:20432979-20433001 GTGTGTGCATGTGTGGAAGTAGG - Intergenic
903036713 1:20497847-20497869 TTGTGAGGACGTGTGGATGTAGG + Intergenic
903337948 1:22637370-22637392 GTGTGAGTGTGTGAAGATGTGGG + Intronic
903634792 1:24804523-24804545 GTGGGGGGATGTGTGTATGTGGG + Intronic
903675500 1:25062179-25062201 GTGTGAGTATGTGTGTGTGTTGG + Intergenic
903867304 1:26409271-26409293 GTGTGTGCACGTGCGGATGTGGG - Intergenic
904470395 1:30732283-30732305 GTGTGAGTGTGTGGGTATGTGGG + Intergenic
904995874 1:34630946-34630968 GGGATAGGATGTGAGGATTTGGG - Intergenic
905474007 1:38213240-38213262 GGGTGAGGATGTTGGGATGAGGG - Intergenic
905892781 1:41527703-41527725 GGGTGAGCATGTGAGGGTGGGGG - Intronic
905893114 1:41529322-41529344 ATGTGTGAATGTGAGGGTGTGGG - Intronic
906080621 1:43086009-43086031 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907849924 1:58246725-58246747 GTGTGATGCTGTGTGCATGTGGG + Intronic
908021771 1:59905464-59905486 GTGTGATGATATTAGGAGGTGGG - Intronic
908067158 1:60418979-60419001 GTGAGTGGATGTGAAGGTGTAGG - Intergenic
908742450 1:67342627-67342649 GTGTGAGGATGTGAGGATGTTGG + Intronic
908925589 1:69250565-69250587 GTGTGACAATGTGTGTATGTGGG - Intergenic
909776948 1:79493599-79493621 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
909909647 1:81245821-81245843 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
909982943 1:82126059-82126081 GTGTGTGGGTGTGTGGGTGTGGG - Intergenic
910486274 1:87717898-87717920 TGGTGAGGATGTGAGGTTTTGGG - Intergenic
910843175 1:91580730-91580752 TGGTGAGGATGTGAGGAAATTGG + Intergenic
911217127 1:95207237-95207259 GGGAGAAGATGTGAGGATATAGG + Intronic
911527862 1:99006888-99006910 GTGTGACCATGTAAGTATGTGGG - Intergenic
911693442 1:100861582-100861604 GTGTGAGTGTGTGTGTATGTGGG - Intergenic
911911623 1:103644512-103644534 GTTTTAGGATGTGAAGATGGGGG + Intergenic
911916831 1:103707438-103707460 GTTTTAGGATGTGAAGATGGGGG - Intronic
911919038 1:103738650-103738672 GTTTTAGGATGTGAAGATGGGGG + Intronic
912345596 1:108960745-108960767 CTGTGAGGAGGTTAGGATGGGGG + Intronic
912353097 1:109033488-109033510 GTGTGTGGAAGTGAGCATGTTGG - Intronic
912384159 1:109263032-109263054 GTGTGAGGATGCCAGAATGGAGG + Intronic
912415061 1:109502474-109502496 GGGGGAGGTGGTGAGGATGTGGG + Intronic
912852766 1:113141217-113141239 GTGTGAGGAGGTGGGGAAGAGGG - Intergenic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913528758 1:119717894-119717916 GGGTGAAGGTGTGAGGATGGGGG + Intronic
913565713 1:120070025-120070047 GTGTGTGGATGTGTGGGTGTAGG - Intergenic
913632416 1:120723529-120723551 GTGTGTGGATGTGTGGGTGTAGG + Intergenic
914286305 1:146229399-146229421 GTGTGTGGATGTGTGGGTGTAGG - Intergenic
914386575 1:147175003-147175025 AAGTGAGGATGTGAGAATGAAGG + Intergenic
914547337 1:148680141-148680163 GTGTGTGGATGTGTGGGTGTAGG - Intergenic
914619178 1:149390219-149390241 GTGTGTGGATGTGTGGGTGTAGG + Intergenic
914855221 1:151345859-151345881 GGAGGAGGATGTGAGGATGATGG - Intronic
915024964 1:152818950-152818972 GTGTGAGGGAGGAAGGATGTTGG - Intergenic
915284154 1:154842251-154842273 GTGTGAGCAGGTGCGGGTGTGGG + Intronic
915537318 1:156544705-156544727 GTGTGTGGGTGTGGGTATGTGGG - Intronic
915912785 1:159924781-159924803 GTGTGAGGTTGTGGGGGTGGTGG - Intronic
916759576 1:167804151-167804173 AGGTGAGGTTGTGAGTATGTAGG - Intergenic
917547144 1:175982880-175982902 GTGGGAGGATGCCAAGATGTTGG + Intronic
919253139 1:195085179-195085201 GTGTGAGTAGGTGTGGATGTGGG - Intergenic
919361485 1:196601195-196601217 GTGTAAGGATGAGAAGATGCTGG - Intronic
919935307 1:202246899-202246921 AGATGAGGAAGTGAGGATGTAGG + Intronic
919981816 1:202646541-202646563 GCATGAGGATTTGAGGATGCAGG - Intronic
920541187 1:206779282-206779304 AGGTGAGGGCGTGAGGATGTGGG - Intergenic
920918348 1:210276841-210276863 GTGTGATGGTATTAGGATGTAGG + Intergenic
921257731 1:213357397-213357419 GTGAGAGGGGGTAAGGATGTTGG + Intergenic
922457927 1:225791676-225791698 AGGTGAGGGCGTGAGGATGTGGG + Intergenic
922808490 1:228402660-228402682 GTGTGATGATGTTAGGAGGCGGG + Intronic
923622086 1:235587635-235587657 GTGTGAGTGTGGGAGGGTGTTGG + Intronic
924009261 1:239646693-239646715 GTGTGTGGATGTGGGTGTGTGGG + Intronic
924029764 1:239874500-239874522 GAGTGAGTATTTGAGGATTTTGG + Intronic
924180336 1:241434377-241434399 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
924202284 1:241672719-241672741 GTTTGAGGATGGGAGCATGGTGG + Intronic
924896313 1:248340588-248340610 GTCTGAGGATCTGAGGTCGTAGG + Intergenic
1062965284 10:1602366-1602388 GTGTGAGGAATTGCTGATGTGGG - Intronic
1062970244 10:1642726-1642748 GAGTGTGGATGTGAGTTTGTGGG - Intronic
1063499563 10:6540862-6540884 TGGTGAGGCTGTGAAGATGTGGG - Intronic
1063663296 10:8048240-8048262 CTGGGTGGCTGTGAGGATGTGGG + Intergenic
1063682445 10:8202156-8202178 GTGGGAGGGTGAGAGGAGGTGGG - Intergenic
1063969026 10:11368315-11368337 AAGTGAGGAAGTGAGGAAGTAGG - Intergenic
1064120705 10:12616096-12616118 GTGTGAGCGTGTGTGTATGTGGG + Intronic
1065367648 10:24951847-24951869 GTGTCCGGATGGGAGGGTGTGGG - Intronic
1065394747 10:25222428-25222450 GTGTGTGGATGTGAGGGAATGGG - Intronic
1065769788 10:29067336-29067358 GTGTGATGAAATGAGCATGTCGG + Intergenic
1065835349 10:29652691-29652713 TTGTGAGGATGTGAAGAAATTGG - Intronic
1065945075 10:30598890-30598912 GTCTGAGGATGAGAGGAGGCAGG + Intergenic
1066564745 10:36709892-36709914 GTGGGAGGATGAGAGGATGAGGG - Intergenic
1066693795 10:38060402-38060424 GTGGGAGGATGTGAGGGGTTTGG - Intronic
1066999020 10:42588739-42588761 GTGGGAGGATGTGAGGGGTTTGG + Intronic
1067202464 10:44185194-44185216 GTGTGTGCATGTGTGGGTGTGGG + Intergenic
1067671126 10:48322626-48322648 GTGTGAGGGTGGGGGCATGTGGG - Intronic
1067947849 10:50701804-50701826 GTGTGAGTATGTGTGTATTTGGG + Intergenic
1068137953 10:52969581-52969603 GTGTGAGGATATGGGGGTGGGGG - Intergenic
1068179934 10:53504200-53504222 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1068595330 10:58896786-58896808 GTGTGTGCATGTGTGGATGTGGG - Intergenic
1069332261 10:67306695-67306717 GTGTGATGATCTGGGGTTGTGGG - Intronic
1069806006 10:71125485-71125507 GTGTGCTGGTGTGTGGATGTGGG + Intergenic
1069854496 10:71432451-71432473 GTGAGAGCATGTGAGTGTGTAGG + Intronic
1070304256 10:75229094-75229116 GTGTAAGAATGTGAGGATAAAGG + Intronic
1070655113 10:78266143-78266165 GTGAGAGCATGTGTGCATGTGGG + Intergenic
1070883164 10:79866801-79866823 GTGTGAGTATGTGTGTATTTGGG + Intergenic
1071058756 10:81544768-81544790 TGGTGAGGATGTGAAGAAGTTGG + Intergenic
1071649732 10:87383108-87383130 GTGTGAGTATGTGTGTATTTGGG + Intergenic
1073612617 10:104959305-104959327 GTGTGAGGGTATTTGGATGTCGG + Intronic
1074437535 10:113446697-113446719 GTGTGCAGATTTGAGGCTGTTGG + Intergenic
1074780483 10:116798601-116798623 GCCTGAGGGTGTGAGCATGTCGG - Intergenic
1075248441 10:120845487-120845509 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1075479029 10:122763518-122763540 TGGTGAGGACGTGCGGATGTGGG + Intergenic
1075913130 10:126143222-126143244 GTGTGTGTCTGTGTGGATGTGGG + Intronic
1076054704 10:127362822-127362844 GTGTGTGTATGTGTGGGTGTGGG - Intronic
1076139342 10:128067431-128067453 GTGTGTGCATGTGTGAATGTGGG - Intronic
1076465083 10:130674654-130674676 ATGTGAGGATGTGAAGAAATGGG - Intergenic
1076601180 10:131657996-131658018 GTGTTGGGAGGTGAGGATGTGGG + Intergenic
1076756193 10:132573266-132573288 GTGTGAGGTTTTGTTGATGTTGG + Intronic
1076756223 10:132573521-132573543 GTGTGAGGTTTTGTTGATGTTGG + Intronic
1076828218 10:132981133-132981155 GTGTGAGTGTGTGAGGATCTGGG + Intergenic
1076940521 10:133603950-133603972 TGGTGAGGATGTGCAGATGTGGG - Intergenic
1076941128 10:133609764-133609786 TGGTGAGGACGTGCGGATGTGGG - Intergenic
1077121391 11:910584-910606 GTGAGAGGGTGTGAGGACGAGGG - Intronic
1077139413 11:1017300-1017322 GTGTGAGGGTGTGATGGGGTTGG + Exonic
1077611885 11:3648394-3648416 GTCTGAGGACCTGAGGTTGTAGG - Intronic
1078561973 11:12380103-12380125 CTGTGAGGAATAGAGGATGTTGG - Intronic
1078961452 11:16277323-16277345 ATGTGAGGATGCCAGGATGCAGG + Intronic
1078982167 11:16548679-16548701 GTAGGAGGATGGGAAGATGTTGG + Intronic
1079963830 11:26956172-26956194 ATTTTAGGAGGTGAGGATGTTGG - Intergenic
1080315018 11:30938080-30938102 GTGAGAGGATGTGGAGAGGTTGG - Intronic
1080416767 11:32076425-32076447 GGAAGAGGATGTGAGGATGAGGG - Intronic
1081713640 11:45233686-45233708 CTGTCAGGAGGAGAGGATGTGGG + Intronic
1083058571 11:59846650-59846672 GTCAGTGGAGGTGAGGATGTAGG - Intergenic
1083772273 11:64874736-64874758 GTGTGAGGAAGTGCTGATTTGGG - Intronic
1083774301 11:64886313-64886335 GTGTGTGTATGTGTGTATGTGGG + Intronic
1084232012 11:67760183-67760205 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1084273317 11:68040103-68040125 GTGTGAGGTCGTGTGGATGAAGG + Intronic
1084694022 11:70743285-70743307 GTGTGAGGGTGTCTGGAGGTGGG + Intronic
1084720996 11:70905538-70905560 GTGTGAGGGTGTTAGGAGCTGGG + Intronic
1084777588 11:71387601-71387623 GTGTGGGACTGTCAGGATGTCGG - Intergenic
1084911185 11:72390678-72390700 TGGTGAAGATGTGAGGATCTGGG + Intronic
1085117107 11:73939068-73939090 TGGTGAGGACGTGAGGATGTGGG + Intergenic
1085779351 11:79394282-79394304 CTGTGGGGATGTGAGGAGGGTGG + Intronic
1086621382 11:88890118-88890140 GGGTGGGGATGTGGGGATGTGGG - Intronic
1086661622 11:89426598-89426620 GAGTGAGGTTCTGAGGGTGTGGG - Intronic
1087025920 11:93649760-93649782 GTGTGGAGATGGGAGCATGTTGG + Intergenic
1088085607 11:105975398-105975420 ATGAGAGGATGTGAGTAAGTGGG - Intronic
1088649963 11:111948808-111948830 GTGTGGGGAAGTGCGGAGGTGGG - Intronic
1088675389 11:112187647-112187669 GTGTGGGGAAGTGCGGAGGTGGG - Intronic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG + Intergenic
1089260141 11:117218619-117218641 GTGTGTGTTTGTGAGAATGTGGG - Intronic
1089287145 11:117414922-117414944 GTGTGATGATATGAGGAGGCGGG - Intergenic
1089569041 11:119390277-119390299 GTGTAAGGACGTGAAGATGCTGG - Intergenic
1089851438 11:121500254-121500276 TTATGAGGTTGTGAGGTTGTAGG - Intronic
1089987099 11:122824918-122824940 GTCTGAGGACTTGAGGTTGTAGG - Intergenic
1090298543 11:125612791-125612813 GTGTGTGTATGTGTGTATGTGGG + Intronic
1090742823 11:129681768-129681790 ATGTGATGGTGTTAGGATGTAGG + Intergenic
1091027901 11:132158404-132158426 GTGCTAGGGTGTGATGATGTGGG - Intronic
1091167178 11:133489918-133489940 GTGTGTGCATGTGTGCATGTAGG - Intronic
1091196828 11:133738711-133738733 GTGTGAGGGTGTGTGTATGTGGG + Intergenic
1091196832 11:133738735-133738757 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091196865 11:133738897-133738919 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091196903 11:133739072-133739094 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091196939 11:133739186-133739208 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091324519 11:134676438-134676460 GTGTGAGGGTATGAGGGTCTTGG + Intergenic
1091388396 12:109722-109744 GTGAGAGGATGTGGAGAGGTTGG - Intronic
1092950603 12:13499587-13499609 GTGGGAGGTTGTGGTGATGTCGG + Intergenic
1093414432 12:18903911-18903933 GGGGGAGGAAGTGAGGATTTGGG - Intergenic
1093763066 12:22932117-22932139 ATGTGATGGTGTGAGGAGGTGGG + Intergenic
1094123196 12:26995632-26995654 GTGTGATGATATTAGGAGGTGGG + Intronic
1094167726 12:27459755-27459777 ATGTGAGGATGTGAGTGTGATGG - Intergenic
1094214774 12:27929190-27929212 GTGTGATGGTGTTAGGAGGTGGG - Intergenic
1094316355 12:29140244-29140266 GTCTGAGGATCTGAGGTTGTAGG + Intergenic
1094800085 12:34022825-34022847 GTCTAAGGATGGGAGGACGTGGG - Intronic
1094802050 12:34048422-34048444 AGGTGAGGACGTGAGGATGTGGG - Intergenic
1095115182 12:38344330-38344352 AGGTGAGGACATGAGGATGTGGG - Intergenic
1095115190 12:38344360-38344382 TGGTGAGGATGTGCAGATGTAGG - Intergenic
1095511833 12:42959451-42959473 GTGTGATGGTGTTAGGACGTGGG + Intergenic
1095824471 12:46516816-46516838 TTGTGAGGTGGTGAGGATGTGGG + Intergenic
1096031024 12:48414884-48414906 GTGTGAGTATGTGTGCATGCAGG - Intergenic
1096227828 12:49878096-49878118 GTGTGTGCATGTGTGTATGTGGG + Intronic
1096562735 12:52448400-52448422 GTGAGAGGATGTGAGGCAGGAGG - Intronic
1096693501 12:53335082-53335104 GTGTGTGGAGGAGAGGAGGTAGG - Intronic
1096973634 12:55685964-55685986 GTGTGAGCATGTGGGAGTGTGGG - Intronic
1097173388 12:57129355-57129377 GTGGGGGGTTGTGAGGATGTAGG - Intronic
1097398254 12:59102163-59102185 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098883378 12:75939375-75939397 CTGGGAGGATGGGAGGCTGTGGG + Intergenic
1098914243 12:76240719-76240741 TGGTGAGGACGTGAGGATGCGGG - Intergenic
1099065074 12:77965863-77965885 GTCTTAGAATGTTAGGATGTGGG - Intronic
1099518178 12:83624737-83624759 GTGAGAGGGTGTGAGGGAGTAGG - Intergenic
1099574731 12:84363895-84363917 GTCTGAGAATGAGAGGATGGAGG - Intergenic
1100526657 12:95425937-95425959 TGGTGAGGATGTGGGGAAGTTGG - Intergenic
1100552044 12:95654871-95654893 ATGATGGGATGTGAGGATGTTGG + Intergenic
1100552046 12:95654879-95654901 ATGTGAGGATGTTGGGATGTTGG + Intergenic
1100552101 12:95655103-95655125 ATGATGGGATGTGAGGATGTTGG + Intergenic
1100552103 12:95655111-95655133 ATGTGAGGATGTTGGGATGTTGG + Intergenic
1100552188 12:95655447-95655469 ATGTGGGGATGTTGGGATGTTGG + Intergenic
1100787850 12:98097519-98097541 ATTCGAGGATGTGAGGATTTTGG + Intergenic
1101294620 12:103408386-103408408 GGGTGTGGAGGTGAGGAAGTAGG + Intronic
1101412777 12:104483103-104483125 GGGTGAGCATGTGAAGATGCAGG - Intronic
1101649443 12:106661530-106661552 GGGTGATGATGTGTGAATGTAGG - Intronic
1101834721 12:108287312-108287334 GTGGGTGGATGAGTGGATGTTGG + Intergenic
1102599938 12:114022055-114022077 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1102807449 12:115794419-115794441 GAGTGAGGAAGTGAGGAGGTGGG + Intergenic
1103052559 12:117792907-117792929 GTGTGAGGGTGTGTGCATGTTGG - Intronic
1103052562 12:117792929-117792951 GTGTGAGCGTGTGTGCATGTTGG - Intronic
1103052573 12:117793201-117793223 GTGTGAGGGTGTGTGCATGTTGG - Intronic
1103052577 12:117793239-117793261 GTGTGAGGGTGTGTGCAGGTTGG - Intronic
1103052587 12:117793342-117793364 GTGTGAGGGTGTGTGCATGCTGG - Intronic
1103359497 12:120345557-120345579 GTGGCAGGAGGTGAGGATGTGGG - Exonic
1103932894 12:124459963-124459985 GCGAGAGCATGTGAAGATGTGGG - Intronic
1104290555 12:127462525-127462547 ATGTGAAGATGTGAGGCTGCTGG - Intergenic
1104367262 12:128189274-128189296 GTGTGAGAATGTGAGGGTGAGGG + Intergenic
1104367283 12:128189469-128189491 GTGTGAGAATGTGAGGGTGAGGG + Intergenic
1104457709 12:128929008-128929030 GTGTGAGGGTATTAGGAGGTGGG + Intronic
1104470316 12:129024900-129024922 GTGTGGGGGTGTGAGCATGTGGG - Intergenic
1104470366 12:129025148-129025170 GTGTGTGGGTGTGAGCATGTGGG - Intergenic
1104777058 12:131396301-131396323 ATGTGATGACGGGAGGATGTTGG + Intergenic
1105601265 13:21890058-21890080 GTGTGTGCATGTGTAGATGTGGG - Intergenic
1105601282 13:21890680-21890702 GTGTGTGCATGTGTGTATGTGGG - Intergenic
1105671041 13:22616381-22616403 GTATGAGGATGGGAAGAAGTAGG - Intergenic
1105759316 13:23498853-23498875 GTGCGCGTATGTGGGGATGTGGG + Intergenic
1105989114 13:25600632-25600654 GTGTAAGGATGCCAGGACGTTGG - Intronic
1106408127 13:29491492-29491514 GTGTGTGTATGTGGGGGTGTGGG + Intronic
1106475593 13:30095531-30095553 GTGTGATGGTGTTAGGAGGTGGG - Intergenic
1106560734 13:30844078-30844100 GTGTGTGGGTGTGTGGGTGTGGG + Intergenic
1106978549 13:35251330-35251352 TGGTGAGGATGTGAGGAAGCTGG - Intronic
1107198281 13:37682017-37682039 CTGTGAGGATGTGATGGGGTAGG + Intronic
1107356084 13:39568737-39568759 GTGTGAACATTAGAGGATGTAGG - Intronic
1108035448 13:46285780-46285802 GGGTGAGGAGGTGAGGAGTTGGG + Intergenic
1110021385 13:70478126-70478148 GTGTAAGGATGTGTAGATGATGG - Intergenic
1111934528 13:94545884-94545906 GTGTGAGGAGGGGAGGGTGAAGG - Intergenic
1112416184 13:99205315-99205337 TTGTGAGGAGGTGAGGATCCGGG + Intronic
1112447414 13:99477327-99477349 GTGTGTGTATGTGTGCATGTGGG + Intergenic
1112748357 13:102553243-102553265 GGGTCAGGATTTGATGATGTAGG - Intergenic
1112979579 13:105366030-105366052 GAGTGAGGAAGAGAGGAAGTGGG - Intergenic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113055168 13:106259847-106259869 GTGTGGGGGTGTGGGGGTGTGGG + Intergenic
1113327196 13:109293670-109293692 GTGTGAGGTTGTGTGTGTGTAGG - Intergenic
1113399251 13:109976141-109976163 ATGTGAGGAGGTGAGGTTGTGGG + Intergenic
1113591604 13:111505356-111505378 GTCTGTGGATGTGAGGAAGGGGG - Intergenic
1113593331 13:111515416-111515438 GTGTGAGGGTCTGAGGGTGGAGG + Intergenic
1113593340 13:111515445-111515467 GTGTGAGGGTCTGAGGGTGGAGG + Intergenic
1113593349 13:111515474-111515496 GTGTGAGGGTCTGAGGGTGGAGG + Intergenic
1113809226 13:113127957-113127979 GCGTGAGCATGTGAGGAGGCTGG + Intronic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1115208437 14:30939853-30939875 ATGGGAGGAAGTGTGGATGTGGG - Intronic
1116113359 14:40615312-40615334 GTGTGAGGGTATTAGGAGGTGGG + Intergenic
1116950097 14:50871701-50871723 GTGGGGGGCTGTGAGGATTTTGG + Intronic
1117825695 14:59701177-59701199 GTGTGAGGATGTGGAGAAATTGG + Intronic
1118321392 14:64755233-64755255 GATGGAGGATGGGAGGATGTGGG + Intronic
1118676952 14:68196459-68196481 GTGTGAAGATGTGGAGAAGTAGG - Intronic
1119031895 14:71199375-71199397 GTGTGAGGCTGTAAGTATGCTGG + Intergenic
1119221236 14:72909455-72909477 GTGTGAGCTTGTTATGATGTTGG - Intergenic
1119809566 14:77505420-77505442 GTGTGGGGAGGTGAGGTAGTGGG - Intergenic
1119819387 14:77601658-77601680 GTCTGAGGACCTGAGGTTGTAGG - Intronic
1121703363 14:95973518-95973540 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1121794981 14:96727340-96727362 ATGTGGGCATGTGGGGATGTGGG + Intergenic
1122296176 14:100706967-100706989 GTGTGAGGGTGTGAGAGTGTAGG - Intergenic
1122296179 14:100707015-100707037 GTGTGAGGGTGTGAGAGTGTAGG - Intergenic
1122594231 14:102878400-102878422 GTGTGGGGGTGTGTGAATGTGGG + Intronic
1122642785 14:103170380-103170402 TGGTGAGGATGTGCAGATGTGGG - Intergenic
1122797800 14:104215087-104215109 GTGTGGGGAGGTGAGTGTGTAGG + Intergenic
1122797817 14:104215174-104215196 GTGTGGGGAGGTGAGTGTGTAGG + Intergenic
1122797905 14:104215581-104215603 GTGTGGGGAGGTGAGTGTGTAGG + Intergenic
1122797920 14:104215657-104215679 GTGTGGGGAGGTGAGTGTGTAGG + Intergenic
1122967904 14:105139797-105139819 GTGTAAGGGTGTGTGGCTGTTGG - Intergenic
1123054657 14:105563541-105563563 GTGTGAGGGTGTGAGGGTTGTGG + Intergenic
1123055767 14:105568928-105568950 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123080124 14:105688447-105688469 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123080172 14:105688701-105688723 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123424164 15:20155724-20155746 GTGAGAGGAAATGAGGATGGCGG + Intergenic
1123533384 15:21162253-21162275 GTGAGAGGAAATGAGGATGGCGG + Intergenic
1124250766 15:28105307-28105329 GTGTGTGCATGTGTGGGTGTGGG + Intergenic
1124859730 15:33427182-33427204 GTGTGGGTATGTGAGTCTGTGGG + Intronic
1125021495 15:34991056-34991078 CTGTGAAGATTTGAGGGTGTGGG + Intergenic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1125816995 15:42594162-42594184 GTGTGAGGATGTCAGGAACCTGG + Intronic
1127117717 15:55743584-55743606 GTGTGAGGGTAGGAGGGTGTAGG - Intergenic
1127167644 15:56263714-56263736 TTGTCAGGATCTGAGGATATGGG - Intronic
1127383120 15:58446554-58446576 GTCTGAGGTTGTGAGCATCTTGG + Intronic
1127837846 15:62805132-62805154 CTGAGAGGATGTGAGGTTGGGGG - Intronic
1130752863 15:86731348-86731370 GTCTTAGGATCTGAGAATGTTGG - Intronic
1130847046 15:87757288-87757310 GTGAGAGGATGTGTGGAGGGCGG - Intergenic
1130971531 15:88737501-88737523 GTGTGATGACGTTAGGAGGTGGG + Intergenic
1131179458 15:90230088-90230110 GTGGGAGGGTGTGAGGATGAAGG - Exonic
1131512186 15:93055572-93055594 GTGTGATGATGTGTGGCTGCCGG - Intronic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1131839813 15:96425049-96425071 GTGGGAGGCTGAGAGGAGGTGGG + Intergenic
1132243237 15:100276326-100276348 GTGGGAGGGTGGGAGGGTGTGGG + Intronic
1132243267 15:100276405-100276427 GTGGGAGGGTGGGAGGGTGTGGG + Intronic
1132340118 15:101073026-101073048 GTCTGAGGACTTGAGGTTGTAGG - Intronic
1132399869 15:101498636-101498658 GAGTAAGGAGGTGAAGATGTGGG - Intronic
1132518944 16:378654-378676 GTGGGAGGCTGAGAGGAGGTGGG - Intronic
1132870974 16:2115626-2115648 CTGTGAGGAGGGGAGGGTGTTGG + Intronic
1132871355 16:2117093-2117115 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1133429143 16:5721343-5721365 GGGTGTGGATGTGGGTATGTGGG + Intergenic
1133443136 16:5837179-5837201 GTGGGAGGAGGAGAGGAGGTGGG - Intergenic
1133542905 16:6773461-6773483 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542919 16:6773556-6773578 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542929 16:6773632-6773654 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133542939 16:6773712-6773734 GTGTGTGTATGTGTGGGTGTGGG + Intronic
1133836615 16:9373367-9373389 GTGTGATGTTGTTAGGAGGTTGG + Intergenic
1133869672 16:9675457-9675479 GTGTGAGGAGGGGAGGTGGTAGG + Intronic
1133890713 16:9876395-9876417 TGGTGAGGACGTGCGGATGTGGG - Intronic
1134186873 16:12091406-12091428 GTGTGATGGTGTTAGGAGGTGGG + Intronic
1134310210 16:13069735-13069757 GTGTGTGCAGATGAGGATGTGGG + Intronic
1134521172 16:14919801-14919823 CTGTGAGGGTGGGAGGATGGAGG + Intronic
1134550399 16:15136171-15136193 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1134708848 16:16318452-16318474 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134716059 16:16358486-16358508 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134950757 16:18350193-18350215 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1134958697 16:18393673-18393695 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1135231936 16:20716643-20716665 AGGTGAGGGTGTGAGGATGTGGG - Intronic
1135833531 16:25800713-25800735 GTGTGATCATGTGAAGAGGTGGG + Intronic
1136173298 16:28501215-28501237 GTGTGAGTGTGAGAGTATGTGGG - Intronic
1136270629 16:29146322-29146344 CTGTGGGGATGTGGGGATGGGGG + Intergenic
1136270674 16:29146472-29146494 CTGTGGGGATGTGGGGATGGAGG + Intergenic
1136649918 16:31660328-31660350 AGGTGAGGATGTGAGGATGTGGG - Intergenic
1136650763 16:31668165-31668187 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1136786967 16:32940488-32940510 GGGTAAGGATGCGAGGTTGTGGG + Intergenic
1137415520 16:48274671-48274693 GTGTGTGGATGTGTGGGTGTGGG - Intronic
1137578383 16:49618911-49618933 GTGAGAGAAGGTGAGGATGTTGG - Intronic
1138091610 16:54179061-54179083 CTGTGATGATGTGATGATATGGG - Intergenic
1138423173 16:56913001-56913023 GTGGGAGGAGGTGAGGTCGTGGG + Intronic
1138759324 16:59522419-59522441 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1138948392 16:61880379-61880401 GTGATAAGATGTGAAGATGTTGG + Intronic
1138954365 16:61952984-61953006 ATGTGAGGATGGTAGGAGGTAGG + Intronic
1139039717 16:62984994-62985016 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1139054731 16:63168720-63168742 GTATTAGGAGGTGAGGATTTTGG + Intergenic
1139527368 16:67525212-67525234 GTGTGTGTATGTGAGTGTGTGGG - Intronic
1139552327 16:67681269-67681291 GTGTGAGGCAGAGAGGAGGTGGG + Intronic
1139914857 16:70421642-70421664 GACTGGGGATGTGAGGAGGTGGG + Intronic
1140194263 16:72844006-72844028 GGGTGAGTGTGTGCGGATGTAGG - Intronic
1140673859 16:77306887-77306909 GAGTGAAGATGTGAGGTTTTAGG - Intronic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1141858841 16:86703138-86703160 GTGTGTGGGTGTGGGGGTGTGGG - Intergenic
1141858855 16:86703180-86703202 GTGTGTGGGTGTGTGGGTGTGGG - Intergenic
1142074207 16:88108103-88108125 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074217 16:88108133-88108155 CTGTGGGGATGTGGGGATGGGGG + Intronic
1142074226 16:88108163-88108185 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074253 16:88108253-88108275 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142279037 16:89138172-89138194 GTGGGAGGCTGAGAGGCTGTGGG - Intronic
1142431686 16:90031946-90031968 GTGTGGGGAGGTGAGCACGTGGG + Intronic
1142639155 17:1275583-1275605 GTGTGAGTGTGTGAGTGTGTGGG + Intergenic
1143471067 17:7176325-7176347 GTGTGAGAGTGTGAGAATGAGGG - Intronic
1143471073 17:7176424-7176446 GTGTGAGAGTGTGAGAATGACGG - Intronic
1143490674 17:7283701-7283723 GAGTGAGGCTGTGAGGGTGAGGG - Intronic
1143831481 17:9655322-9655344 GTGTGAGCATGTGGGCATCTGGG - Intronic
1144105798 17:11984100-11984122 GTCTCAGGAGGTGAGGGTGTGGG - Exonic
1144726016 17:17503144-17503166 GTGTCAGGAGGTGAGGCAGTGGG - Intergenic
1145049877 17:19651015-19651037 GTGTGAGTATGTGTGTATATAGG + Intronic
1146163058 17:30570254-30570276 CTGTGAGGATCTGAGGAGATGGG + Intergenic
1146271167 17:31486974-31486996 GTGTGTGCATGTGTGGGTGTGGG + Intronic
1147173019 17:38632471-38632493 GTGTGTGTGTGTGAGGGTGTGGG - Intergenic
1147219264 17:38919110-38919132 GTGTGGGTATGTGAGGAGCTGGG - Exonic
1147608800 17:41789252-41789274 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
1147816867 17:43216625-43216647 GTGTGTGGATGTGTGGTAGTGGG + Intronic
1148044194 17:44732407-44732429 GTGGGAGGATGTGGGGAAGGGGG + Intronic
1148661147 17:49333887-49333909 TGGTGAGGATGTGAAGATATTGG + Intronic
1149407266 17:56366473-56366495 GTGAGTGAATGTGAGGACGTAGG - Intronic
1149788323 17:59455096-59455118 GTGTGATGGTGTTAGGAGGTAGG - Intergenic
1150603895 17:66675212-66675234 GTGTGAGGATGTGGGGCTGTCGG - Intronic
1151414703 17:73953527-73953549 GTGTGTGAATGTGAGTGTGTGGG - Intergenic
1151559724 17:74863873-74863895 GTGAGAGGGTGTGAGGAGGCTGG - Intronic
1151616409 17:75215578-75215600 GCGTGAGGATGTTAGGTGGTGGG - Intronic
1151748627 17:76024552-76024574 GTGCGAGGAGGTGGGGATGGGGG - Intronic
1152247307 17:79191766-79191788 GTGTGGGGAGGTGAGTCTGTAGG - Intronic
1152526903 17:80893507-80893529 GTATGAGGGTGTGTGTATGTCGG + Intronic
1152641840 17:81452520-81452542 GTGTGTGGATGGTAGGAGGTGGG + Intronic
1152733485 17:81985181-81985203 GTGTGTGGATGTGTGCATGTTGG - Intronic
1152844920 17:82593743-82593765 GGGTGAGGATTTGATGATGTGGG + Intronic
1153662061 18:7333806-7333828 GTGTGAGGATGAGAGGATCCCGG - Intergenic
1153912168 18:9713961-9713983 ATGTGAGGATATTAGGAGGTGGG - Intronic
1154146306 18:11869029-11869051 GTGTGTGGGTGTGTGGGTGTGGG - Intronic
1155221128 18:23687101-23687123 TTGTGAGGATGTGGAGAAGTTGG - Intergenic
1155796554 18:30044818-30044840 AGGTGAGGATGTGAGGACGTGGG - Intergenic
1155932462 18:31721898-31721920 GTGTGTGTATGTGTGTATGTGGG + Intergenic
1156449954 18:37261254-37261276 GAGTGAGGATGGGAGGAGGAAGG - Intronic
1157103396 18:44750441-44750463 GTGTGATGATATTAGGAGGTGGG - Intronic
1157105942 18:44774399-44774421 GTGTGGGGGTGTGTGGGTGTAGG + Intronic
1157192830 18:45595792-45595814 GTGTGTGGAAGTGAGGAAGCCGG - Intronic
1157474204 18:48011080-48011102 GTGTGAGGAGGTGGGGAGGTAGG + Intergenic
1157479472 18:48044323-48044345 ATGGGAGGATGTGGAGATGTAGG - Intronic
1157523628 18:48362352-48362374 ATGTGATGGTGTGAGGAGGTGGG + Intronic
1157557516 18:48622361-48622383 GTGTGAGCATGGGAGTGTGTGGG + Intronic
1157893978 18:51446986-51447008 GTGTGTGGAGGTGTGGGTGTGGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159366402 18:67470939-67470961 GTGTGAATATGTGGGGATGAGGG + Intergenic
1159423787 18:68257774-68257796 GTGGGGGGATGTGAGGCAGTAGG - Intergenic
1160004390 18:75059057-75059079 GTGTGCGGAGGTGAGGACATTGG + Intronic
1160394926 18:78564097-78564119 GTGTGGGAATATGAGGTTGTGGG - Intergenic
1160400363 18:78606392-78606414 GTGTGAGGGTGTGTGTGTGTGGG - Intergenic
1160840922 19:1146750-1146772 GTGGGAGGCTGTGAGGGTGGGGG + Intronic
1161226516 19:3149070-3149092 GTGTGTGGGTGTGTGCATGTGGG - Intronic
1162006642 19:7785048-7785070 TGGTGAAGATGTGAGGAAGTGGG - Intergenic
1162327753 19:10008919-10008941 GTGTGAGAATTTGAGCACGTGGG + Intronic
1162362105 19:10226757-10226779 GTGTGAGGAAGGCGGGATGTAGG + Intronic
1162859533 19:13495734-13495756 GTGGGTGGATGGGTGGATGTTGG - Intronic
1163149070 19:15400555-15400577 GTGGGAGGATGTGAGGTTTCTGG - Intronic
1163919239 19:20273327-20273349 TGGTGAGGATGTGTGGATGTGGG + Intergenic
1165231513 19:34390204-34390226 TTGTCAGTATCTGAGGATGTGGG + Intronic
1165332876 19:35151094-35151116 GGGGGTTGATGTGAGGATGTAGG - Intronic
1165642460 19:37401859-37401881 TAGTGAGGATGTGAAGATATTGG - Intergenic
1165752238 19:38267419-38267441 GTGTGAGGGAGGGAGGATGGGGG + Intronic
1166257585 19:41617615-41617637 GTGGGAGGAGGTGGAGATGTGGG + Intronic
1166499266 19:43328843-43328865 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1166546725 19:43638787-43638809 GTGTGGGGAAGTGAGAATGGGGG - Intronic
1167049810 19:47071475-47071497 GTGTGAGGCTGAGAGGCTGGTGG - Intronic
1168145400 19:54417227-54417249 GTGTGTGCATGTGAGTGTGTTGG - Intronic
1168461867 19:56566602-56566624 GTGTGATGACGTTAGGAGGTGGG - Intergenic
925088933 2:1137415-1137437 GTGTGTGCATGTGTGGGTGTGGG - Intronic
925434083 2:3820846-3820868 GTCTGAGGACCTGAGGTTGTAGG + Intronic
926054408 2:9766070-9766092 GTGTGAGCGTGTGTGCATGTGGG - Intergenic
926112156 2:10190309-10190331 GTGTGATGATGTGATGGTGGTGG + Intronic
926146691 2:10400758-10400780 GTGTGTGTATGTGTGCATGTGGG - Intronic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926591678 2:14746330-14746352 GTGTGAGTATATGAGCGTGTGGG - Intergenic
926591699 2:14747043-14747065 GTATGAGTATGTGAGTGTGTGGG - Intergenic
926890329 2:17634000-17634022 GTCTGAGGAGGTGAGGGTGGTGG + Intronic
927360788 2:22230263-22230285 GTGTGAGCATGTTAAAATGTTGG + Intergenic
927964620 2:27261608-27261630 GTGTGGGGGTGTGGGCATGTGGG + Intronic
928587079 2:32770853-32770875 GTGGGAAGACTTGAGGATGTTGG + Intronic
928779985 2:34806203-34806225 GTCTGAGGATCTGAGGTTGTAGG + Intergenic
929381256 2:41357006-41357028 GAGTGTGGGTGTGAGCATGTGGG - Intergenic
929841659 2:45472116-45472138 GTGTGTGTATGTGTGGGTGTGGG - Intronic
930341406 2:50120333-50120355 GTGTGTGCATGTGTGCATGTTGG - Intronic
930688723 2:54336805-54336827 GAGTGAGGGAGTGAGCATGTAGG + Intronic
932270572 2:70405430-70405452 TGGTGAGGATGTGAGGATGTGGG - Intergenic
932285947 2:70531929-70531951 GTGTGAGTATGTGAGAGTGTGGG - Intronic
932295527 2:70620985-70621007 GTCTGAGGACCTGAGGTTGTAGG - Intronic
933100707 2:78253146-78253168 TGGTGAGGATGTGATGATGTGGG - Intergenic
934060283 2:88286105-88286127 GGGTGAGACTGTGAGGCTGTGGG + Intergenic
934768618 2:96894439-96894461 GGGTGAGTAGGTGTGGATGTGGG - Intronic
935267905 2:101410156-101410178 GTGTGAGCATGTGTGTAAGTGGG - Intronic
935279447 2:101504873-101504895 AGGTGAGGAGGTGAGGAGGTGGG - Intergenic
935423024 2:102890065-102890087 GTGTGTGTATGTGTGTATGTAGG + Intergenic
935469874 2:103445449-103445471 GTGTTTGGATGTGAGGATCTTGG + Intergenic
935524929 2:104153831-104153853 GTGTGTGAATCTGAGCATGTGGG - Intergenic
935539543 2:104333538-104333560 GCTTGAGGAAGTCAGGATGTGGG + Intergenic
935934723 2:108169152-108169174 GTGTTAGGAGGTGGGGAAGTGGG - Intergenic
936526870 2:113247237-113247259 GTGTAAGGAATTGAGGATGTGGG + Intronic
936528745 2:113260361-113260383 GTGTGAGTATGTGTGTGTGTTGG + Intronic
936572016 2:113625419-113625441 GTGTGAGGAAGTCAGGCTTTCGG + Intergenic
936794512 2:116189190-116189212 GTCTGAGGATCTGAGGTCGTAGG + Intergenic
937245259 2:120488363-120488385 GTGTGTGTATGTGGGGATGGGGG + Intergenic
937910719 2:127074280-127074302 GTGTGGGGATGGCAGGGTGTGGG - Intronic
937961371 2:127462566-127462588 GTGTGAGGATGTGGAGAAATGGG + Intronic
938109812 2:128556360-128556382 GTGTGAGGGTATCAGGAGGTGGG + Intergenic
938730705 2:134144831-134144853 GAGTGATGATGTCATGATGTGGG + Intronic
939054471 2:137347057-137347079 TGGTGAGGATGTGGGGATATTGG - Intronic
939869389 2:147510137-147510159 GTGTTAGGATGTGGGGACTTTGG - Intergenic
941492137 2:166155417-166155439 GAGTGTGGATGGGAGGATGCAGG + Intergenic
941654855 2:168132482-168132504 GTGTGGGGAGATGAGGATGGAGG - Intronic
941687832 2:168465455-168465477 GTGTGATGGTGTTAGGAGGTGGG - Intronic
942561670 2:177226531-177226553 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
943158030 2:184209895-184209917 GAGTGGGGATGTGGGGGTGTGGG + Intergenic
943834868 2:192506578-192506600 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
945375808 2:209078557-209078579 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
945894941 2:215471226-215471248 GTGTGAGGCTGTGGGTATGTTGG + Intergenic
946115357 2:217457001-217457023 GTGTGTGGGGGTGAGGATGAGGG - Intronic
947077377 2:226360053-226360075 CTGTGAGTATGTGAATATGTTGG + Intergenic
947110627 2:226715561-226715583 GTGTGGTGGTGTGAGTATGTGGG + Intergenic
947329120 2:229009714-229009736 GTGTGAGTATATGAGGAACTAGG + Intronic
947356260 2:229299301-229299323 GTGTGAGGATGTGTGAGTGGGGG - Intergenic
947572854 2:231249496-231249518 GTGTCAGGATGTGGGGAGGTGGG - Intronic
948299074 2:236888457-236888479 GTCTGAGGATGTGGGCATGGAGG + Intergenic
948383555 2:237567700-237567722 GGGGGAGGCTGTGCGGATGTGGG - Intergenic
948626113 2:239269174-239269196 GTGTGTGGGTGTGTGAATGTGGG - Intronic
948665172 2:239530028-239530050 ATGGGAGGAAGTGAGGGTGTAGG - Intergenic
948692614 2:239716267-239716289 GTGTGAGGGTGTGCGTGTGTGGG + Intergenic
949015278 2:241705824-241705846 GTGAGGGCATGTGAGGGTGTGGG - Intronic
949050931 2:241896809-241896831 GTGTGTGGGTGTGGGGGTGTGGG + Intronic
949053562 2:241911307-241911329 GTGTGTGGGTGTGTGGGTGTTGG - Intergenic
1168844797 20:936638-936660 GTGTTAGGATGTGGGGACTTTGG - Intergenic
1168967610 20:1908418-1908440 GTGGGAGGGTGTGAGTGTGTGGG - Intronic
1170134760 20:13060591-13060613 GTGGGAGGGTGGGAGGAGGTAGG - Intronic
1171008221 20:21489359-21489381 GTGTGATGCTGTTAGGAAGTGGG - Intergenic
1171116338 20:22527742-22527764 AAGTGGGGATGTGATGATGTAGG + Intergenic
1171207372 20:23291525-23291547 GTGTGAGGGTATGTGGGTGTGGG - Intergenic
1172304585 20:33872005-33872027 GTGTGAGGTTGAGATGAGGTAGG + Intergenic
1172548766 20:35782610-35782632 GTATGTGGTGGTGAGGATGTAGG + Intronic
1172568575 20:35951428-35951450 GTGAGTGAATGTGAAGATGTAGG - Intergenic
1173788261 20:45811010-45811032 GTTGGGGGAAGTGAGGATGTAGG - Intronic
1174656024 20:52172815-52172837 GTGTGAGGCTGTGAGCTTCTTGG - Intronic
1175180710 20:57144872-57144894 GTGTGATGGTGTTAGGAGGTGGG - Intergenic
1175608862 20:60333529-60333551 GTGTGATGGTGTTAGGAGGTGGG - Intergenic
1175627581 20:60501477-60501499 GGGTGAGGTTGTGGGGATGGGGG + Intergenic
1175643390 20:60650288-60650310 GTGTGAGTATATGTGAATGTAGG + Intergenic
1175643394 20:60650356-60650378 GTGTGGGTATGTGAGTGTGTGGG + Intergenic
1175880306 20:62254189-62254211 ATGTGACAATGTTAGGATGTGGG - Intronic
1176430454 21:6572174-6572196 GTGTGAGAATGTGTGAGTGTGGG + Intergenic
1176795392 21:13368216-13368238 GGGTGAGGATGTGCCGGTGTGGG + Intergenic
1176795449 21:13368390-13368412 GTGTGAGGGTGTGTGGGTGAGGG + Intergenic
1176946605 21:14989786-14989808 GTGTGTGGAGGTGAGGAGGAGGG + Intronic
1177100341 21:16892699-16892721 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1178000969 21:28161927-28161949 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1178467875 21:32865192-32865214 GTGTGTGTATGTGAGTGTGTTGG + Intergenic
1178930572 21:36814975-36814997 GTGTGTGGATGTGTGGCTGAGGG + Intronic
1179095338 21:38309601-38309623 CTGTGAGGCTGTGAGTCTGTTGG - Intergenic
1179452465 21:41475398-41475420 GAGTGAGGAGGTGAGCAGGTGGG + Intronic
1179629220 21:42666345-42666367 GTGTGAGGCTGTGGGGAAGGAGG + Intronic
1179643002 21:42759458-42759480 GGGTGTGGATGTGAGCATGGGGG + Intronic
1179705848 21:43179636-43179658 GTGTGAGAATGTGTGAGTGTGGG + Intergenic
1179966680 21:44810915-44810937 GTGTGGGCATGTGTGGGTGTGGG - Intronic
1180086763 21:45511025-45511047 GTGGGGGGGTGTGTGGATGTGGG - Intronic
1180147007 21:45927325-45927347 GGGAGAGGAGGGGAGGATGTAGG - Intronic
1180766927 22:18350775-18350797 GTGTGAGTGTGTGGGGGTGTGGG + Intergenic
1180812102 22:18768924-18768946 GTGTGAGTGTGTGGGGGTGTGGG - Intergenic
1181198261 22:21203171-21203193 GTGTGAGTGTGTGGGGGTGTGGG - Intergenic
1181533868 22:23531909-23531931 GTGTGTGCATGTGCGCATGTTGG + Intergenic
1181729713 22:24835800-24835822 GTGTGAGGTGGTGAGGACTTGGG + Intronic
1181791434 22:25270280-25270302 GTGTGAGCATGTGAGTGTGGGGG - Intergenic
1181827128 22:25526391-25526413 GTGTGAGCATGTGAGTGTGGGGG - Intergenic
1182841167 22:33391152-33391174 CTATGAGGATGTGAGGATATTGG - Intronic
1182841287 22:33392090-33392112 CTCTGAGGATGTGAGGATATTGG - Intronic
1182957235 22:34437980-34438002 GTGTGTGTATGTGAGAGTGTAGG + Intergenic
1183633313 22:39046295-39046317 CTGTGAGGAGGTGGGGATGAGGG + Intronic
1183799905 22:40153728-40153750 TTGTGAGGAAGGGAGGATGGAGG + Intronic
1184833763 22:47008281-47008303 GGTTGAGGATGTGAGCATCTTGG + Intronic
1185181850 22:49368281-49368303 GTGTTTGGATGTGAAGATCTTGG - Intergenic
1185185354 22:49396015-49396037 GTGTGATGGGGTGAAGATGTGGG - Intergenic
1185339033 22:50283490-50283512 GGGTGAGGGTGTCAGGGTGTGGG - Intronic
1203228546 22_KI270731v1_random:91666-91688 GTGTGAGTGTGTGGGGGTGTGGG + Intergenic
949315991 3:2756255-2756277 GTGTGATCATATGAGGAGGTGGG + Intronic
949615768 3:5752269-5752291 GTGTGTGTATGTGAGAAGGTGGG - Intergenic
950528592 3:13539433-13539455 TTGTGTGGGTGTGAGGTTGTTGG + Intergenic
950576139 3:13833167-13833189 GTGTGAGGGTGTGAGCCTGTGGG - Intronic
951106216 3:18746383-18746405 GTGTGTGGCAGTGAGGATTTGGG - Intergenic
951562889 3:23985882-23985904 TGGTGAGGATGTGGGGAAGTTGG + Intergenic
951811559 3:26706235-26706257 GTGTGAGGATATTTGGAGGTGGG - Intronic
951894633 3:27599516-27599538 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
953456312 3:43045036-43045058 AGGTGAGGGTGTGAGGATGTGGG + Intronic
954452248 3:50577970-50577992 GTGTGTGGCTGTGTGGCTGTTGG - Intronic
954945980 3:54424749-54424771 ATGTGGGGATGGGAGGATGCAGG - Intronic
954972514 3:54663257-54663279 GTGGGAAGATCTGTGGATGTTGG + Intronic
955238502 3:57160581-57160603 GTGTGAGGATGGGAGGAGCAGGG - Intronic
955928891 3:64035990-64036012 GTGTGTGGATATGTGGGTGTGGG - Intergenic
956498225 3:69851835-69851857 TTGTGAGCATGTGAGCATATTGG - Intronic
956708953 3:72023620-72023642 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
959365274 3:105450424-105450446 GTGTGTGTATGTGAGGTAGTGGG - Intronic
959638280 3:108601249-108601271 GTGTGTGGATGTGTGGGTGTGGG + Intronic
959847843 3:111055209-111055231 TGGTGAGGATGTGTGGATGTGGG - Intergenic
960580782 3:119276852-119276874 ATGTGAAGATGTGAAGATGAAGG - Intergenic
960809701 3:121615990-121616012 GTGTGAGGGTGTCTGGCTGTGGG - Intronic
960845708 3:122002765-122002787 GTTGGAGGGTGTGGGGATGTAGG - Intronic
961002818 3:123385336-123385358 GTGTGTGGCTGTGAGTATGTGGG + Intronic
961638846 3:128352165-128352187 GTGTCAGGAGGTGAGGATGGGGG - Intronic
961781187 3:129321002-129321024 GTGTGAGCATGTGAGTAGGAGGG - Intergenic
961880729 3:130059647-130059669 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
962025118 3:131539689-131539711 GTGTGGGGAAGTGGGGAGGTGGG + Intronic
962660383 3:137596136-137596158 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
962712641 3:138100785-138100807 GTGCCAGGCTCTGAGGATGTGGG - Intronic
963520220 3:146354314-146354336 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
963729736 3:148959687-148959709 GAGTGATGCTGTGAGGAAGTAGG - Intergenic
963743093 3:149098451-149098473 GTGTGAGGAAATGAGGACTTTGG - Intergenic
963949602 3:151184618-151184640 GACTGAGGATGAGAGGATGTTGG - Intronic
964385266 3:156140570-156140592 GTGTGATGATATTAGGATATAGG - Intronic
964525424 3:157611566-157611588 CTGTGAAGATGTGGGCATGTTGG + Intronic
965070041 3:163908023-163908045 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
965724506 3:171700079-171700101 GTGTGCATATGTGAGCATGTGGG - Intronic
966417717 3:179706512-179706534 GTGTGATGAGTTGAGGATATTGG + Intronic
966891909 3:184413350-184413372 GAGTGTGTATGTGAGGATGAAGG + Intronic
967248486 3:187513058-187513080 GAGTGAGGATCTGTGGGTGTGGG - Intergenic
967907545 3:194514137-194514159 TTGGGAGGATGTGTGTATGTGGG - Intergenic
967993673 3:195150763-195150785 GTGTGAGTGTGTGCGTATGTGGG - Intronic
968120846 3:196124818-196124840 GTGTGAGGATGTGATGCTTGAGG - Intergenic
968194470 3:196695136-196695158 GTGTGTGGGTGTGTGAATGTGGG - Intronic
968194510 3:196695360-196695382 GTGTGTGGGTGTGTGGGTGTGGG - Intronic
968315208 3:197718224-197718246 GGGAGAGAATGTTAGGATGTGGG - Intronic
968522942 4:1042418-1042440 GTGTGTGCATGTGTGGGTGTAGG - Intergenic
968614878 4:1573137-1573159 GAGTGTGAATGTGAGAATGTGGG - Intergenic
968742145 4:2336660-2336682 GAGTGAGGATGTGAGGATTGAGG + Intronic
968742206 4:2336972-2336994 GAGTGAGGAGGTGAGGAGTTAGG + Intronic
968993108 4:3927935-3927957 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
969230031 4:5823914-5823936 CTGTGAGGTTGTTATGATGTTGG + Intronic
969356016 4:6626403-6626425 GTATTAGGAGGTGGGGATGTTGG - Intergenic
969410916 4:7027605-7027627 GTGTGTGGATGTGACTGTGTAGG - Intronic
969476481 4:7425126-7425148 GTGGGAGGATCTGAGGCTCTGGG - Intronic
969514642 4:7639669-7639691 GTGTGTGAGTGTGAGGGTGTGGG + Intronic
969916175 4:10493557-10493579 GTGTTAGGAGGTGAGGACTTTGG - Intronic
969917990 4:10509334-10509356 GTGTCAGGAAGTGAGGCTGCAGG - Intronic
969979638 4:11141508-11141530 AGGTGAGGAGGTGAGGGTGTGGG - Intergenic
970029481 4:11658758-11658780 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
970084444 4:12330963-12330985 CTTTGAGGATGTCAGGATATTGG - Intergenic
970087297 4:12364354-12364376 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
971033212 4:22663680-22663702 GTTTCAGGATGTGAAAATGTGGG - Intergenic
973054629 4:45640663-45640685 AGGTGAGGATGTGAGGACATGGG - Intergenic
973195469 4:47434753-47434775 TTGGGATGATGTGTGGATGTTGG - Intergenic
973551568 4:52040451-52040473 GTGTGATGATATTAGGAGGTAGG + Intergenic
973880837 4:55269672-55269694 GGGTGGGGATGGGAGGATGGAGG - Intergenic
975184851 4:71389470-71389492 GAATGAGGATGTGAGGATGGAGG - Intronic
975630961 4:76401854-76401876 GTATGAGGATGTGGCTATGTAGG + Intronic
975865405 4:78719162-78719184 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
976530126 4:86142147-86142169 GTGTGTGGTTGTTGGGATGTGGG - Intronic
976940771 4:90699771-90699793 ATGTGATGATGGTAGGATGTGGG + Intronic
977368464 4:96102692-96102714 GTGTGAGTATGTGTGTGTGTTGG + Intergenic
977432434 4:96947340-96947362 GTGAGAGGATGGGAGGAGGTTGG + Intergenic
977916412 4:102599119-102599141 GTGTGAGGATTTGAGGGGGAGGG + Intronic
978001406 4:103558933-103558955 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
978113472 4:104991061-104991083 GAGGGAGGATGGGAGAATGTGGG + Intergenic
978571103 4:110138716-110138738 GTGATAAGATGTGTGGATGTGGG + Intronic
978751999 4:112260184-112260206 GTGTAAGAAGGTGAGTATGTTGG + Intronic
979478044 4:121181223-121181245 ATGGGAGGATATGAGGATGAGGG + Intronic
979991232 4:127378292-127378314 GTGTGAGGGTGGGAGTATATGGG - Intergenic
980899173 4:138888030-138888052 GTGTGAGGAAGTCAGGAAGAGGG + Intergenic
982248140 4:153376273-153376295 GTGTGTGGATGTGTGTTTGTGGG + Intronic
982406070 4:155021537-155021559 GAGTGAGGCTCTGTGGATGTGGG + Intergenic
983023583 4:162709671-162709693 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
983707424 4:170678132-170678154 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
984067947 4:175072919-175072941 GTGTGAGGGGGTGTGGGTGTTGG + Intergenic
984205713 4:176785538-176785560 GAGTGGGGATGTGAGGAGGTGGG - Intronic
984402766 4:179287972-179287994 GTGTTGGGATGTGGGGATGCTGG + Intergenic
984501768 4:180566462-180566484 GTGTGAGGGTGAGTGGGTGTAGG + Intergenic
985421267 4:189787313-189787335 GTGTGAGTGTGTGAGTCTGTGGG - Intergenic
985515931 5:344504-344526 GTGTGTGTGTGTGAGGCTGTGGG + Intronic
985515948 5:344591-344613 GTGTGTGTGTGTGAGGCTGTGGG + Intronic
985515965 5:344678-344700 GTGTGTGTGTGTGAGGCTGTGGG + Intronic
985516097 5:345480-345502 GTGTGGGGATGTGTGTATGTGGG + Intronic
985637577 5:1045973-1045995 GTGTGAGGGTGTGTGAATGAGGG + Intergenic
985974261 5:3403046-3403068 GTGAGTGGATGTGAGGACCTAGG - Intergenic
986279798 5:6313926-6313948 GAGTGAGCATCAGAGGATGTGGG - Intergenic
986279818 5:6313988-6314010 GAGTGAGCATCAGAGGATGTGGG - Intergenic
986812576 5:11375953-11375975 GTGTGATGGTGTTAGGAGGTGGG + Intronic
986867895 5:12011276-12011298 TTGTGAATATGTGAGGATGAGGG - Intergenic
987076886 5:14391706-14391728 GCATAAGGTTGTGAGGATGTTGG + Intronic
987272340 5:16324474-16324496 GTGTGAGGAAGTGTGAGTGTGGG + Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
987785588 5:22494315-22494337 GTGTGAGTGGGTGTGGATGTGGG + Intronic
988660024 5:33255769-33255791 TTGTGAGGGAGTGAGGAAGTAGG - Intergenic
988700707 5:33671739-33671761 GTGTGTGTTTGTGAGTATGTGGG - Intronic
988700716 5:33671831-33671853 GTGTGTGTATGTGAGTGTGTGGG - Intronic
988700726 5:33671923-33671945 GTGTGTGTATGTGAGTATGTGGG - Intronic
988700730 5:33671994-33672016 GTGTGTGTATGTGAGTATATGGG - Intronic
988700733 5:33672036-33672058 GAGTGTGTATGTGAGTATGTGGG - Intronic
988807529 5:34754129-34754151 AGGAGAGGATGAGAGGATGTAGG + Intronic
989152513 5:38314431-38314453 TTATGTGAATGTGAGGATGTGGG + Intronic
989173746 5:38499821-38499843 GTGAGAGGATGTGAGGCAGAGGG - Intronic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
991096957 5:62749873-62749895 GTGTGAGAATATTAGGAGGTGGG + Intergenic
991154191 5:63411186-63411208 TGGTGAGGATGTGAGGGAGTTGG - Intergenic
991181991 5:63763287-63763309 ATGTGATGATGTCAGGATGCAGG - Intergenic
992383069 5:76257621-76257643 GTGTGTGGGTGTGGGTATGTAGG + Intronic
992517878 5:77514218-77514240 GTATGATTATGTGCGGATGTAGG - Intronic
993137194 5:83984255-83984277 GTGTGTGAAAGTGAGGTTGTGGG + Intronic
993966855 5:94369530-94369552 GTGTGAGAATGAGAGGATTGAGG + Intronic
994502160 5:100592882-100592904 GTGTGAAGATGAGAAGATCTAGG - Intergenic
994731611 5:103498483-103498505 GTGAGAGGATGCAAGGGTGTGGG + Intergenic
995276678 5:110285444-110285466 GTGTGTGCATGTCAGCATGTGGG + Intergenic
995538253 5:113158935-113158957 GTGTGTGGAGGGGTGGATGTGGG + Intronic
995674606 5:114649323-114649345 GTGCGAGTATGTGTGGTTGTAGG - Intergenic
995791969 5:115898594-115898616 GTGTGAGGATTTCTGCATGTGGG + Intronic
996203564 5:120702851-120702873 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
996907996 5:128623796-128623818 ATGTCTGCATGTGAGGATGTGGG - Intronic
997365405 5:133322262-133322284 GTGTGTGGGTGTGTGGGTGTGGG - Intronic
997365415 5:133322304-133322326 GTGTGTGGGTGTGTGGGTGTGGG - Intronic
997746131 5:136301921-136301943 GTGTGAGGACCTGAGGTCGTAGG - Intronic
998005541 5:138654520-138654542 GGAGGAGGAGGTGAGGATGTGGG + Intronic
998472950 5:142397659-142397681 GTGTGAGGACCTGAGAAGGTGGG + Intergenic
999075869 5:148794744-148794766 GTGTGAGCACGGGAGGATGTGGG + Intergenic
999267908 5:150278820-150278842 GTGTGATGCTGTGAGGCTGTAGG + Intronic
1000115511 5:158149911-158149933 CTGTGAGGATGTGAGGATGCAGG + Intergenic
1000311051 5:160045070-160045092 ATGTGAGGATGTGTGGGTTTGGG + Intronic
1000459651 5:161498971-161498993 ATGTGAGGACGTGAGGACGTGGG - Intronic
1000459658 5:161499009-161499031 TGGTAAGGATGTGTGGATGTGGG - Intronic
1000606697 5:163334819-163334841 GTCTGAGGATCTGAGGTCGTAGG - Intergenic
1000875843 5:166637280-166637302 GTGTGAGGTGGGCAGGATGTCGG - Intergenic
1001979832 5:176030890-176030912 GGGTGGGGATGTGAGGGTGGGGG + Intronic
1001979905 5:176031084-176031106 GGGTGGGGATGTGAGGGTGGGGG + Intronic
1002090244 5:176800797-176800819 GTGTGTGCATGTCTGGATGTGGG + Intergenic
1002237473 5:177812581-177812603 GGGTGGGGATGTGAGGGTGGGGG - Intergenic
1002819105 6:707197-707219 GAGTGTGGACGTGAGGATGTAGG - Intergenic
1003430485 6:6033077-6033099 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1003505856 6:6739987-6740009 GTGGGGGGATGGGAGGATGCAGG - Intergenic
1003729023 6:8799620-8799642 GTGTGTGTATGTGAGCATGAGGG + Intergenic
1003781063 6:9427371-9427393 GTGTGTGCATGTGTGGGTGTGGG + Intergenic
1004696540 6:18039135-18039157 TTGTGAGGATGTGAAGAAATTGG + Intergenic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1005246392 6:23890516-23890538 GTGACAGGATCTGATGATGTTGG + Intergenic
1005593466 6:27352734-27352756 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1005786810 6:29252262-29252284 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1006023624 6:31133019-31133041 GTGGTGGCATGTGAGGATGTGGG + Intronic
1006099462 6:31677170-31677192 GTGTGGGGATGAGAGGATTTGGG - Intronic
1006682927 6:35810232-35810254 GTGTGATGGTGTTAGGAGGTGGG - Intronic
1006784772 6:36658938-36658960 GTGTAAGGAGGTGGGGAGGTTGG + Intergenic
1007694175 6:43721410-43721432 ATGTGAGAATGTGAGAATGGTGG - Intergenic
1007709333 6:43811824-43811846 GTGTGGGGATGTGAGGATGGGGG + Intergenic
1008374987 6:50781335-50781357 GTGTGGGGAGGGGATGATGTGGG - Intergenic
1009595053 6:65725247-65725269 GTGTGAGCATGTGGGTGTGTGGG - Intergenic
1009973415 6:70648437-70648459 GTGTGAGGATGGGATGTTGAGGG + Intergenic
1010587037 6:77665890-77665912 GTGTGAGGACCTGAGGTCGTAGG + Intergenic
1011602776 6:89075335-89075357 GTGTGATAATGTTAGGACGTGGG - Intergenic
1012072074 6:94635072-94635094 GTTTGAGGATGTTAAAATGTGGG - Intergenic
1012454416 6:99388934-99388956 GTGGGAGAGAGTGAGGATGTGGG - Intronic
1012886569 6:104853052-104853074 GTGTGAAGAGGTGAGGCTTTGGG + Intronic
1013318074 6:108960348-108960370 GTGTGAGGATGAGAAGAGGCAGG - Intronic
1013455276 6:110324261-110324283 CTGTGGGGATGTGAGACTGTGGG - Intronic
1013906157 6:115222443-115222465 GAGTGAGGCTCTGTGGATGTGGG - Intergenic
1014360474 6:120467573-120467595 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1014718318 6:124890926-124890948 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1014937087 6:127397660-127397682 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1014937094 6:127397690-127397712 TGGTGAGGATGTGAGGATGTGGG - Intergenic
1015062969 6:128989965-128989987 ATGTGAGGATATCAGGAGGTGGG - Intronic
1015323512 6:131902091-131902113 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1015482769 6:133731657-133731679 GTATAAGGAGGTGAGGATTTAGG - Intergenic
1015821609 6:137267062-137267084 GTGTGGTGATGTTGGGATGTGGG - Intergenic
1016013199 6:139159515-139159537 GTTTGAGGAAGTGAGGGTGAGGG + Intronic
1016204250 6:141453312-141453334 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1016646521 6:146415314-146415336 GTGTGATGATATTAGGAAGTGGG - Intronic
1017120540 6:151019947-151019969 TTGTGAGGGTGTGGGGTTGTAGG - Intronic
1017825080 6:158075824-158075846 CTGAGAGGATGTGAGAATGTTGG - Intronic
1017855057 6:158343465-158343487 GTGTTAGGAAGTGAGGCTTTGGG + Intronic
1017882715 6:158572900-158572922 TTGTGAGGTTGTGAGGTTGTGGG + Intronic
1017889501 6:158627044-158627066 GTGTGAGGGTGTGAGAATGAGGG - Intronic
1018378842 6:163239721-163239743 GTGTGAGTGTGTGTGTATGTGGG - Intronic
1018378844 6:163239745-163239767 GTGTGAGTGTGTGTGCATGTGGG - Intronic
1018627573 6:165794380-165794402 GTGTGAGCATGTGTGAGTGTGGG - Intronic
1018898212 6:168035892-168035914 GTGTGTGGATGTGATGAGGGAGG - Intronic
1018900944 6:168051450-168051472 CGGTGAGGTTGTGAGGATGGAGG + Intergenic
1019105434 6:169663726-169663748 AGGTGAGGATGTGAGGGTGCTGG + Intronic
1019261016 7:82064-82086 GTGGGAGGGTGTGTGGGTGTGGG - Intergenic
1019433775 7:1011589-1011611 GTGTGTGGCTGTGGGTATGTTGG - Intronic
1019453115 7:1109880-1109902 CCGTGAGGAGGTGAGGATGGAGG - Intronic
1019487238 7:1294975-1294997 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487248 7:1295026-1295048 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487250 7:1295034-1295056 GTGTGTGGATGTGGGTGTGTGGG + Intergenic
1019487307 7:1295317-1295339 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487325 7:1295400-1295422 GTGTGTGTGTGTGTGGATGTGGG + Intergenic
1019487327 7:1295408-1295430 GTGTGTGGATGTGGGTGTGTGGG + Intergenic
1020211391 7:6160297-6160319 GTGAGGGGCTGTGAGGATGGAGG + Intronic
1020392404 7:7672374-7672396 GTGTGAGCATGTGTGTATGAGGG + Intronic
1020510622 7:9052508-9052530 GGGTGAGGATGGGGAGATGTTGG - Intergenic
1020627477 7:10599767-10599789 GTGAGAAGAGGTGAGAATGTAGG + Intergenic
1020691060 7:11355117-11355139 GAGTGAACATGTGAGAATGTTGG + Intergenic
1021095192 7:16527458-16527480 GTGTGTGTGTGTGTGGATGTGGG + Intronic
1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG + Intergenic
1022126988 7:27367921-27367943 GTGTGAGTCTGTGAGTGTGTGGG - Intergenic
1022186936 7:27978851-27978873 GTGTGAGGGCGTGAGGGTGTAGG + Intronic
1022843055 7:34182839-34182861 GTGTGATGATATTAGGAGGTAGG + Intergenic
1023263021 7:38377257-38377279 GTGAGAGGATGTGAAGACCTAGG - Intergenic
1023901722 7:44486491-44486513 GTGTGGGGAGATGATGATGTAGG + Intronic
1024229291 7:47351899-47351921 CTGTGTGCATGTGAGTATGTGGG - Intronic
1024473646 7:49788703-49788725 GTGAGAGGATGTATGGGTGTGGG + Intronic
1024492015 7:49996379-49996401 GAGTAAGGATGTGTGGAGGTCGG - Intronic
1024779924 7:52836129-52836151 CAGTTAGTATGTGAGGATGTGGG - Intergenic
1025109716 7:56203862-56203884 GTGTGATGATATTAGGAAGTGGG - Intergenic
1025248568 7:57336414-57336436 GTGTGATGCTGTCAGAATGTCGG - Intergenic
1025258346 7:57400115-57400137 GTGGGAGGGTGTGGGGATGGGGG + Intergenic
1025709216 7:63891688-63891710 GTGGGAGGGTGTGGGGATGTGGG - Intergenic
1026016600 7:66676369-66676391 GCTTGAGTATGTGAGGATTTTGG - Intronic
1026308197 7:69160757-69160779 GTGTGATGATTTTAGGAAGTGGG + Intergenic
1026500043 7:70936329-70936351 GTGTGTGTATGTGTGTATGTGGG + Intergenic
1026827401 7:73593242-73593264 GTGTGTGGATGTGTGTGTGTGGG - Exonic
1027318299 7:76997628-76997650 GTATGTGGAGGTGGGGATGTGGG + Intergenic
1027318506 7:76998478-76998500 GTGTGTGGAGGTGGGGGTGTGGG + Intergenic
1027318563 7:76998710-76998732 GTGTGTGGAGGTGGGTATGTGGG + Intergenic
1027318571 7:76998734-76998756 GTGTGTGGAGGTGAGGGTGTGGG + Intergenic
1027811664 7:82909379-82909401 GGGAGAGAATGTGTGGATGTGGG - Intronic
1027839684 7:83293036-83293058 GTGTGAGTATGTGGGTGTGTAGG + Intergenic
1027945355 7:84738390-84738412 GTGTGAGGATATTAGGAGTTGGG + Intergenic
1028488465 7:91385350-91385372 GTGTGTGTATGTGTGTATGTTGG + Intergenic
1029158883 7:98537093-98537115 AAGGGAGGATGGGAGGATGTTGG + Intergenic
1030068889 7:105681409-105681431 TGGTGAGGATGTGGGGAAGTTGG + Intronic
1030157412 7:106469002-106469024 GTTTCAGGAAGTGAGGAAGTGGG - Intergenic
1030751794 7:113238730-113238752 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1030866214 7:114704511-114704533 GTGTTAGGAAGTGAGGCTCTTGG - Intergenic
1031009977 7:116515916-116515938 GTGTGTGTGTGTGTGGATGTAGG - Intergenic
1031422737 7:121569160-121569182 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1031525259 7:122817264-122817286 GTCTGAGGACCTGAGGTTGTAGG - Intronic
1031685587 7:124729642-124729664 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1031728216 7:125264081-125264103 GTCTGAGGACGTGAGGTCGTAGG + Intergenic
1032158860 7:129494574-129494596 GTGTGTGAATGTGAAGGTGTAGG + Intergenic
1032284910 7:130532551-130532573 TTGTGTGGATGTGAGGAGGAGGG + Intronic
1032415018 7:131729219-131729241 GTTTGAGGGGGTGAGGATGAAGG + Intergenic
1033126749 7:138713376-138713398 GTGTGTGTATGTGAGTTTGTGGG + Intronic
1033422025 7:141212126-141212148 GGATGAGGATGGGAGGATGGAGG + Intronic
1033465318 7:141583935-141583957 GTCTGAGGACCTGAGGTTGTAGG + Intronic
1033638040 7:143230630-143230652 GTGTGTGAATGTGAGTGTGTGGG - Intergenic
1033638043 7:143230676-143230698 GTGTGTGAATGTGAGTGTGTTGG - Intergenic
1033638054 7:143230939-143230961 GTGTGTGAATGTGAGTGTGTTGG - Intergenic
1034533845 7:151714468-151714490 GTGCGTGGATGGGAGGATGGCGG - Intronic
1034673780 7:152876923-152876945 GTGCGATGATGTGCAGATGTGGG - Intergenic
1034895518 7:154873989-154874011 GTGTGTGTATGTGTGCATGTGGG - Intronic
1034897107 7:154883872-154883894 GTGTGAGCATGTATGTATGTGGG - Intronic
1034968764 7:155406945-155406967 GTGTGAGAGTGTGGGGGTGTGGG + Intergenic
1034969057 7:155408169-155408191 GTGTGAGAATGTGGGAGTGTGGG + Intergenic
1035302553 7:157907000-157907022 GTGTCAGGGTGTCAGGATCTCGG - Intronic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1035768269 8:2126363-2126385 GTGTGGGGATGTGAGTGTGTGGG - Intronic
1035960260 8:4128682-4128704 GTGTGTGGGCGTGAGGTTGTGGG - Intronic
1036155240 8:6336028-6336050 GGGGGAGGCTGTGAGCATGTGGG - Intergenic
1036591949 8:10176406-10176428 CTGAGGGGATGTGAGGATGGTGG + Intronic
1037164372 8:15809215-15809237 CAGTGAGGGTGTGAGGATGTTGG + Intergenic
1037255931 8:16953556-16953578 GTGTGGGGATGAAAGGAGGTGGG + Intergenic
1037579758 8:20237359-20237381 GTGTGTGGATGTGTGGATGTGGG - Intergenic
1037613526 8:20496311-20496333 GTGTGATGGTGTTAGGAGGTGGG + Intergenic
1037674654 8:21043161-21043183 GTGTGGGGAGGTGGGGATGTGGG - Intergenic
1037992724 8:23332226-23332248 GTGTGGGGGTGTGAGTGTGTAGG - Intronic
1038358027 8:26848328-26848350 GTGTGATGGTGTTAGGAGGTGGG + Intronic
1038402943 8:27299103-27299125 GTGTTAGAATGTCAGGATGCAGG - Intronic
1039593339 8:38769008-38769030 GTGCGTGGATATGAGGCTGTGGG + Intronic
1039802341 8:40970176-40970198 TTTTGAGGCTGTGAGAATGTGGG + Intergenic
1040852833 8:51919578-51919600 GTGTGATGATATTAGGAGGTGGG - Intergenic
1041436764 8:57850309-57850331 ATGTGATGATATGAGGACGTAGG - Intergenic
1041671846 8:60499723-60499745 TGGTGAGGATGTGTGGATGTGGG - Intergenic
1041718141 8:60950620-60950642 GTGGGAGGGTGTGGGGAGGTGGG + Intergenic
1041917619 8:63152304-63152326 GTGTGAGGATGGGAGGTGATAGG + Intergenic
1042826610 8:72986064-72986086 GGGTGAGGGTGGGAGGCTGTTGG + Intergenic
1042865408 8:73352667-73352689 ATGTGATGATATGAGGATGTGGG + Intergenic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1044463195 8:92471589-92471611 GTGTGTGCATGTGTGTATGTGGG - Intergenic
1044650111 8:94485113-94485135 GGATGAGAATGTGAGAATGTAGG - Intergenic
1044993992 8:97821525-97821547 TAGTGAGGACGTGTGGATGTAGG + Intronic
1045483220 8:102609620-102609642 GTGTGAGGATGTGATGTTTGTGG - Intergenic
1046621502 8:116533461-116533483 GTGTGAGGGAGTGTGGTTGTGGG - Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1047506764 8:125486335-125486357 ATGTGGGGATGTCGGGATGTCGG - Intergenic
1048097312 8:131310652-131310674 GTCTGAGGACTTGAGGTTGTAGG - Intergenic
1048549304 8:135419076-135419098 GTGGGAGGCTGTGGGGAGGTGGG + Intergenic
1048577699 8:135706097-135706119 GTCTGTGGATGTGGGGATGCTGG + Intergenic
1048618241 8:136103183-136103205 GTGAGAGGGTGTGAGGAAGGTGG - Intergenic
1049588336 8:143442047-143442069 CTGTGTGGCTGGGAGGATGTGGG - Intronic
1049625919 8:143620771-143620793 GTATGAGGAGGTGAGGACTTTGG - Intergenic
1049692554 8:143968860-143968882 TGGTGAGGATGTGAGGAAATTGG + Intronic
1050080989 9:1915773-1915795 GTGTGAGGGTGTGAGGATGAAGG - Intergenic
1051550981 9:18329049-18329071 GTGTGAGGATATTTGGAGGTGGG + Intergenic
1052733826 9:32319715-32319737 GTGTGATGATGCCTGGATGTGGG - Intergenic
1052892647 9:33718778-33718800 ATGTGATGGTGTTAGGATGTAGG + Intergenic
1053015671 9:34660620-34660642 GTGTGAGGATCAGAGGCTGAGGG - Intronic
1053187502 9:36030351-36030373 GGGTGATGATGTGTTGATGTAGG - Intergenic
1053886804 9:42649927-42649949 GGGTGAGGGTGTGTGGGTGTGGG - Intergenic
1054225823 9:62457377-62457399 GGGTGAGGGTGTGTGGGTGTGGG - Intergenic
1055626400 9:78181190-78181212 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1056060872 9:82884271-82884293 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1056363483 9:85881448-85881470 GTCTGAGGATCTGAGGTCGTAGG - Intergenic
1056363955 9:85884539-85884561 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1056910308 9:90694410-90694432 GTGTGTGAATGTGAGTGTGTGGG + Intergenic
1056910312 9:90694522-90694544 GTGTGTGAATGTGAGTGTGTGGG + Intergenic
1057017701 9:91667400-91667422 TTCTGAGGATGTGAGGAAATGGG - Intronic
1057742903 9:97727499-97727521 GTCTGAGTGTCTGAGGATGTTGG - Intergenic
1058612134 9:106788768-106788790 GTCTGAGGACCTGAGGTTGTAGG - Intergenic
1059525234 9:114985063-114985085 GTGTGAGCATGTGTGGAAGAGGG + Intergenic
1059606993 9:115844369-115844391 GTCTGAGGATCTGAGGTTGTAGG + Intergenic
1060452542 9:123756718-123756740 GTGTGAGGGTGTGTGGGTTTGGG + Intronic
1060595753 9:124847647-124847669 TGGTGAGGATGTGGGGAAGTAGG - Intergenic
1060630959 9:125158118-125158140 GAGTGAAGGAGTGAGGATGTGGG + Intronic
1061209958 9:129185559-129185581 GTGTGAGCATGTGTATATGTGGG - Intergenic
1062013468 9:134279658-134279680 GTGTGAGTGTGTGGGGATGTGGG - Intergenic
1062187495 9:135225889-135225911 GTGTGAGTGTGTGTGTATGTGGG - Intergenic
1062444179 9:136586760-136586782 GTGTGAGCATGTGCATATGTGGG + Intergenic
1185589739 X:1267107-1267129 GTGTGAGGATGTGTGTGTGCAGG + Intergenic
1186936376 X:14454173-14454195 GTGTGTGGGTGTGTGGGTGTGGG - Intergenic
1187131544 X:16507897-16507919 GTGTGTGCATGTGTGTATGTAGG - Intergenic
1187593206 X:20741533-20741555 GTGTGAGTGTGTGTGGAGGTGGG + Intergenic
1188106546 X:26154221-26154243 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106549 X:26154229-26154251 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106552 X:26154237-26154259 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106555 X:26154245-26154267 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1189013841 X:37075425-37075447 GTGGGAGAGTGTGAGGAAGTGGG + Intergenic
1189032046 X:37460752-37460774 GTCTGAGGACCTGAGGTTGTAGG + Intronic
1189363126 X:40368695-40368717 GTGTGTGGGAGTGAGGAGGTTGG + Intergenic
1189768807 X:44401218-44401240 TTGTGAGGGTATGAGGAGGTGGG + Intergenic
1189793948 X:44629567-44629589 GTGTGAGGAAGTGAGGTTGTTGG + Intergenic
1190501012 X:51078460-51078482 GTGTGAGGATATTAGCAGGTGGG + Intergenic
1191178551 X:57534355-57534377 GTCTGAGGCTCTGAGGCTGTAGG - Intergenic
1191864746 X:65694893-65694915 GTGTGAAGAATGGAGGATGTAGG + Intronic
1192256727 X:69467549-69467571 GTGTGGGGATCTTAGGAGGTAGG + Intergenic
1192616279 X:72626143-72626165 GTATGTGTATGGGAGGATGTAGG + Intronic
1193024011 X:76824431-76824453 TGGTGAGGATGTGAGGAAATTGG - Intergenic
1193229976 X:79032348-79032370 GAGTGAGGCTCTGTGGATGTGGG + Intergenic
1193286874 X:79724086-79724108 TTTTGAGGATGTCAGGGTGTTGG - Intergenic
1194184623 X:90759549-90759571 TGGTGAGGATGTGAGGAAATGGG + Intergenic
1194456251 X:94107295-94107317 CTGTCAGGAAGTGAGGAGGTGGG + Intergenic
1194647915 X:96481203-96481225 GTGGGATGAGGTGAGGATGGGGG + Intergenic
1194823073 X:98529513-98529535 GTCTGAGGACCTGAGGTTGTAGG + Intergenic
1195391490 X:104366902-104366924 GGGTGAGGGTGAGGGGATGTGGG - Intergenic
1195478930 X:105320606-105320628 GTGTGAGGATATGTGAGTGTGGG + Intronic
1196442470 X:115728858-115728880 GCGTTAGGATGGGAGGATGGTGG + Intergenic
1196443087 X:115732046-115732068 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196443747 X:115735015-115735037 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196445408 X:115843961-115843983 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196446079 X:115846942-115846964 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196446750 X:115849923-115849945 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196447418 X:115852906-115852928 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196448089 X:115855885-115855907 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196448758 X:115858876-115858898 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196449429 X:115861867-115861889 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196450098 X:115864850-115864872 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196450768 X:115867835-115867857 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196451439 X:115870814-115870836 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196452110 X:115873801-115873823 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196452780 X:115876770-115876792 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196453450 X:115879763-115879785 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196454119 X:115882772-115882794 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196454786 X:115885761-115885783 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1196455200 X:115887843-115887865 GCGTTAGGATGGGAGGATGGTGG - Intergenic
1197013160 X:121591726-121591748 ATGTGATGATGTTAGGAGGTGGG + Intergenic
1197118554 X:122862943-122862965 ATGTGAGTATGTGAGTGTGTGGG - Intergenic
1197122900 X:122913480-122913502 GTGTGTGCATTTGAGGAAGTAGG + Intergenic
1197354537 X:125420963-125420985 GTGTGATAATGTGACAATGTGGG + Intergenic
1197590855 X:128408256-128408278 GTGTGTGGATGTATGGGTGTAGG + Intergenic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic
1198847587 X:140929352-140929374 GTGTGTGGAGGGGAGGAGGTGGG + Intergenic
1199061515 X:143361193-143361215 GTAGGAGGATGGGAGAATGTGGG - Intergenic
1199533216 X:148872759-148872781 ATGTGAGGATATCAGGATGAGGG - Intronic
1199814235 X:151383613-151383635 GTGTGATGGTATGAGGAGGTGGG + Intergenic
1200531220 Y:4341551-4341573 TGGTGAGGATGTGAGGAAATGGG + Intergenic
1200929913 Y:8687733-8687755 GTGTGTGGATGTGTTCATGTAGG - Intergenic
1201566870 Y:15374398-15374420 GTTGGAGGATGGGAGGATGGGGG + Intergenic