ID: 908751275

View in Genome Browser
Species Human (GRCh38)
Location 1:67426134-67426156
Sequence GAGGCGAATTTTCAGTTGAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908751275_908751278 -1 Left 908751275 1:67426134-67426156 CCTATCAACTGAAAATTCGCCTC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 908751278 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG 0: 2
1: 1
2: 4
3: 16
4: 388
908751275_908751282 26 Left 908751275 1:67426134-67426156 CCTATCAACTGAAAATTCGCCTC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG 0: 1
1: 1
2: 2
3: 4
4: 13
908751275_908751281 23 Left 908751275 1:67426134-67426156 CCTATCAACTGAAAATTCGCCTC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG 0: 1
1: 1
2: 2
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908751275 Original CRISPR GAGGCGAATTTTCAGTTGAT AGG (reversed) Exonic
907646572 1:56250519-56250541 GAGGCCATTTTTCAGATGAAAGG - Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG + Intergenic
916334102 1:163650608-163650630 GAGGAGAATTTTCTGTTCATGGG - Intergenic
917723545 1:177809079-177809101 GAGGGTAATTTTCACTTGGTGGG - Intergenic
920009102 1:202854915-202854937 GAGGCCCATTATCAGATGATGGG - Intergenic
922585090 1:226728011-226728033 GTGGTGAATTTTCAGCTGAAGGG - Intronic
924075245 1:240327347-240327369 GATGCAGGTTTTCAGTTGATAGG - Intronic
1066263512 10:33752392-33752414 GAGACGACATTTCAGCTGATAGG + Intergenic
1075708710 10:124518739-124518761 GAGGCCCATTCTCAGTTTATAGG - Intronic
1076540695 10:131213004-131213026 GAGGGTCATTTTCAGCTGATGGG - Intronic
1080174583 11:29346795-29346817 GAGACGACTTTGGAGTTGATAGG + Intergenic
1087250718 11:95896146-95896168 GAGGTGATATTTCAGTTGAGAGG - Intronic
1099019285 12:77383157-77383179 GAAACGAATTTTCAGCAGATGGG + Intergenic
1101197545 12:102400410-102400432 GATACCAATTTTCAGTTGAATGG + Intronic
1113996768 14:16090481-16090503 GAGGTGAACTTTCTTTTGATTGG - Intergenic
1115493160 14:33978410-33978432 GAAGCCAATTTTGAGTTGATGGG - Intronic
1119067965 14:71549741-71549763 GAGGGCAAGTTTCAGTTGAGAGG - Intronic
1122869983 14:104634104-104634126 GCGGCGAGTTTTCACCTGATGGG - Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1144247288 17:13379615-13379637 GAAGCCAAATATCAGTTGATTGG + Intergenic
1147488904 17:40845394-40845416 GAGGAGAATTTTGAGAAGATGGG + Intergenic
1149281792 17:55112975-55112997 GAAGAGAAATTTCAGTAGATTGG + Intronic
1151054187 17:71012803-71012825 AAGGAGAAGCTTCAGTTGATAGG + Intergenic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG + Intronic
937738221 2:125316956-125316978 GAGATGACTTTCCAGTTGATTGG + Intergenic
938134016 2:128739020-128739042 GTGGCTAATTTTCAGCTGACCGG + Intergenic
938474271 2:131592299-131592321 GAGGCAAATTATAACTTGATCGG - Intergenic
944202314 2:197120768-197120790 GAGGTGAATGTTGAGCTGATAGG - Intronic
944640754 2:201723058-201723080 AAGGAGAATTTTCAGATGACTGG - Exonic
947944698 2:234091606-234091628 GATGCCAATTTTCTGTTGAATGG - Intergenic
1180310155 22:11216795-11216817 GAGGTGAACTTTCTTTTGATTGG + Intergenic
1182389513 22:29980506-29980528 GTGGGGAATTCTCAGTTGCTGGG - Intronic
957652639 3:83028868-83028890 CAGGCTTTTTTTCAGTTGATAGG - Intergenic
959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG + Intronic
959702152 3:109308730-109308752 GTGGAGAATTTACAGTTTATGGG - Intronic
962936665 3:140087786-140087808 GAGGTGAATTTTGAGTTAAGTGG + Intronic
965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
972411375 4:38798739-38798761 AAAGTGAATTTTTAGTTGATAGG - Exonic
974274443 4:59699581-59699603 GAGGCAAATTTTCAGTTTGTAGG + Intergenic
976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG + Intronic
977876314 4:102154714-102154736 GAGGCAAATTCTCTGTTGAGGGG + Intergenic
979346847 4:119597808-119597830 GAGGCCAATTTTCAACTGAGAGG + Intronic
986855018 5:11858333-11858355 CAGGCAAATATCCAGTTGATAGG + Intronic
989176357 5:38530869-38530891 GAGGCCAATTTTCAAATGATGGG + Intronic
991583195 5:68177782-68177804 GAGGTAAATTTTGAGCTGATGGG + Intergenic
1003399210 6:5778035-5778057 GAGGGAAATTTTCAGGTGATGGG + Intergenic
1006878285 6:37317192-37317214 GAGGAGGATTTTCAGGTGAGTGG + Exonic
1009511159 6:64551495-64551517 GAGGGGTCTCTTCAGTTGATTGG - Intronic
1014031996 6:116716696-116716718 GAGGCAAAATATCAGTAGATAGG - Intronic
1022114273 7:27248792-27248814 CAGGCGTATTTTCAGTTAATAGG + Intergenic
1023110273 7:36803214-36803236 GAGGCTTATTTTTAGTGGATAGG - Intergenic
1024433139 7:49314374-49314396 AATTTGAATTTTCAGTTGATAGG - Intergenic
1030791586 7:113736296-113736318 GAGGTGAAAATTCAGTTCATTGG + Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG + Intronic
1035128043 7:156624748-156624770 GATGCAAAATTTCAGTTAATAGG + Intergenic
1041279082 8:56193578-56193600 GAGTAGAATTATCAGTTGATTGG - Intronic
1041793447 8:61721957-61721979 AAGGAGGATTTTCTGTTGATTGG - Intergenic
1047023260 8:120799660-120799682 GAGTCCAATGTTCAGTTAATAGG + Intronic
1047888062 8:129274845-129274867 AAGGAGAATTGGCAGTTGATTGG + Intergenic
1050199912 9:3133200-3133222 GAGGAGAAGTCTCAGCTGATTGG + Intergenic
1056719705 9:89061149-89061171 GAGGTGAATTTTCTGATGGTTGG - Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1199728617 X:150608749-150608771 GAGACAAAATTTCAGTTAATAGG - Intronic