ID: 908751278

View in Genome Browser
Species Human (GRCh38)
Location 1:67426156-67426178
Sequence CCTTCACCCTTTTCTTCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 2, 1: 1, 2: 4, 3: 16, 4: 388}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908751275_908751278 -1 Left 908751275 1:67426134-67426156 CCTATCAACTGAAAATTCGCCTC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 908751278 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG 0: 2
1: 1
2: 4
3: 16
4: 388
908751274_908751278 26 Left 908751274 1:67426107-67426129 CCTGGCTCAAAAACAAGAAACAA 0: 1
1: 4
2: 158
3: 1136
4: 20924
Right 908751278 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG 0: 2
1: 1
2: 4
3: 16
4: 388
908751273_908751278 27 Left 908751273 1:67426106-67426128 CCCTGGCTCAAAAACAAGAAACA 0: 1
1: 3
2: 170
3: 1327
4: 21926
Right 908751278 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG 0: 2
1: 1
2: 4
3: 16
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908751278 Original CRISPR CCTTCACCCTTTTCTTCAAG TGG Exonic
900117737 1:1035673-1035695 CCTTCTCCCTGTTCAGCAAGGGG + Intronic
900868020 1:5282664-5282686 CCTTCTGCCCCTTCTTCAAGGGG - Intergenic
905310543 1:37045961-37045983 CCTGCACCCTTTTCTCCACTGGG + Intergenic
905390013 1:37630359-37630381 CCCTCAGCCTTTTCTTCCCGGGG + Intronic
906756546 1:48322739-48322761 CCTTCACCCATTTTTTGATGGGG - Intronic
908185479 1:61648852-61648874 TCTTCGCCCTTTACTTCTAGCGG - Intergenic
908356890 1:63330569-63330591 CCGTTACCCCTTTCTGCAAGGGG + Intergenic
908751278 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG + Exonic
908820601 1:68082121-68082143 CCACCACTCTCTTCTTCAAGGGG - Intergenic
909823235 1:80092815-80092837 CCTCCACCCTTTTCTTCAAGTGG + Intergenic
909961376 1:81848102-81848124 CCTTTTCCCTTTTCTTTCAGAGG + Intronic
911118585 1:94272172-94272194 CCCTCAACCTTTACTTCAACAGG - Intronic
911295091 1:96105544-96105566 CCTTTACACTTTTGTACAAGAGG + Intergenic
911311748 1:96301223-96301245 CCTTCACCCTCTTTTTGATGGGG - Intergenic
912037651 1:105340919-105340941 CCTTTATCCTTTTCATCATGTGG + Intergenic
915653808 1:157341111-157341133 CCTTCACCCACTTTTTGAAGGGG + Intergenic
915768752 1:158395593-158395615 CCATCACTCTTTTCTCCATGGGG - Intergenic
916299552 1:163258601-163258623 TCCACACCCTTGTCTTCAAGAGG + Intronic
917824639 1:178805100-178805122 CCTTCACCCATTTTTTGATGGGG + Intronic
918889125 1:190241181-190241203 TCTTCTACATTTTCTTCAAGAGG - Intronic
920233464 1:204485858-204485880 ACTGCACCCTTTTATTCATGGGG + Intronic
920759886 1:208773024-208773046 CCATCACACTGTTCCTCAAGTGG + Intergenic
921337652 1:214104469-214104491 CCTTCAACCTTGTCTTCACAAGG - Intergenic
921405054 1:214769643-214769665 CCTTCACCCATTTTTTGATGGGG + Intergenic
921934618 1:220785651-220785673 CCTGTGCCCTTTTCTTCATGAGG + Intergenic
922570101 1:226629539-226629561 GCTTCACCCTTTTATTCGATTGG - Intergenic
924285341 1:242480403-242480425 CCTTCAATGTTTTCTTCTAGAGG - Intronic
924575720 1:245279071-245279093 CCTTCCCCATCTCCTTCAAGAGG - Intronic
1062916744 10:1246160-1246182 CCTTCACCCACTTTTTCATGGGG + Intronic
1063340369 10:5257456-5257478 CCTTCACCCACTTCTTGATGGGG - Intergenic
1063623846 10:7671454-7671476 CCTTCAACCTCTGCTTCACGGGG + Intergenic
1065355175 10:24833984-24834006 CATTCATCCTTTTTTTCCAGTGG + Intergenic
1065447563 10:25819042-25819064 CTTCCAGTCTTTTCTTCAAGTGG + Intergenic
1066788098 10:39028274-39028296 CCTTCACCCATTTTTTGATGGGG - Intergenic
1067198729 10:44146924-44146946 CCTTCACCCATTTTTTGATGGGG + Intergenic
1068089191 10:52411645-52411667 CCTTCACCCCCTTCTTCACTGGG - Intergenic
1070044590 10:72819977-72819999 CCCTCAGACTTTTCTTCAATGGG - Intronic
1070377474 10:75847661-75847683 CCTTCACCCATTTTTTAATGAGG - Intronic
1072383595 10:94900488-94900510 CCTTCACCCACTTTTTCATGGGG - Intergenic
1072838112 10:98738640-98738662 CCTTCACCCACTTCTTGATGGGG - Intronic
1075258099 10:120940889-120940911 CCTTAACCCTTCTGTTCAAATGG + Intergenic
1076439369 10:130470072-130470094 ACTTCACCCAGTTCTTCTAGAGG - Intergenic
1078529933 11:12129546-12129568 CCTTAGCCCTTTTCCTAAAGAGG + Intronic
1081205209 11:40267082-40267104 TCTCCACCCTTATCCTCAAGAGG - Intronic
1081226781 11:40533568-40533590 CCTCCAGCCTTTGCTTCAGGAGG + Intronic
1081654855 11:44850418-44850440 CCTTCACCCTTGTCCTCACTGGG - Intronic
1082230774 11:49763246-49763268 CCTTCACCCACTTTTTCATGGGG + Intergenic
1082765396 11:57163619-57163641 AGTTCACCATTTTCTTTAAGGGG - Intergenic
1082956156 11:58872105-58872127 CCTTCACCCATTTTTTGATGGGG + Intronic
1085265486 11:75235646-75235668 CCTTTAGCCTTTCCTTGAAGAGG + Intergenic
1085420320 11:76352710-76352732 CCTTCACCCTCTTCTTCGCTGGG + Exonic
1085785453 11:79444436-79444458 TCTTCAGACTTTTCTGCAAGAGG - Intergenic
1086109727 11:83186943-83186965 CCTTGACCCTCTTCTCCATGTGG - Exonic
1086619275 11:88865726-88865748 CCTTCACCCACTTTTTCATGGGG - Intronic
1087110633 11:94463099-94463121 CCTTCACCCACTTTTTGAAGGGG - Intronic
1088222602 11:107585786-107585808 CCTTCCCCTTTTTCCCCAAGTGG + Intergenic
1088412351 11:109548765-109548787 CCTTTACCCATTTTTTCAAAGGG - Intergenic
1089527785 11:119108124-119108146 CCTTCAGCCTTTCCTTCCAGGGG + Exonic
1089623937 11:119739552-119739574 TCTCCTCCCTTTTCCTCAAGGGG - Intergenic
1090588930 11:128244452-128244474 CCATCACCCTTCTCTTGGAGGGG - Intergenic
1090846131 11:130531551-130531573 CCTTCACCCTTTCTTTCATCAGG - Intergenic
1092123655 12:6061249-6061271 CCTGCACCCCGGTCTTCAAGGGG - Intronic
1092706379 12:11289759-11289781 CCTTCACCCATTTGTTGATGGGG - Intergenic
1093218065 12:16385991-16386013 CCTTCACTCTTTGCTTCATTTGG + Intronic
1093609112 12:21132658-21132680 CCTTCACCCACTTCTTGATGGGG + Intronic
1095104240 12:38212495-38212517 CCTTCACCCACTTCTTGATGGGG - Intergenic
1095561512 12:43571598-43571620 CCTTCACCCTCTTCTTCACTGGG + Intergenic
1095692608 12:45107442-45107464 CCTTCACCCGTTTTTTAATGGGG + Intergenic
1095882269 12:47150610-47150632 CCTTCAGGCTTCTGTTCAAGAGG - Intronic
1095960708 12:47832808-47832830 CCTTCCCACTGTTCCTCAAGAGG - Intronic
1096556040 12:52404493-52404515 CCTCCTCCCTTTTCGTAAAGTGG + Intronic
1096582155 12:52592582-52592604 CCTTCACCCTGTGCTTCATGGGG + Intronic
1096901121 12:54883704-54883726 CCTTCACCCACTTCTTGATGGGG + Intergenic
1098058213 12:66531767-66531789 TCTTAACCAATTTCTTCAAGTGG - Intronic
1098303836 12:69081957-69081979 CCTTCACCCACTTCTTGATGGGG - Intergenic
1099020403 12:77396506-77396528 CTTGCACCCTTTTGTTTAAGGGG + Intergenic
1099041477 12:77659278-77659300 CCTTCACCCACTTTTTCATGGGG - Intergenic
1099511564 12:83545198-83545220 CCTTCACCCACTTTTTCATGGGG + Intergenic
1100529855 12:95453104-95453126 CCTCAACCCTTTTCTCCCAGAGG - Intergenic
1100661792 12:96707678-96707700 CCTTCACTCCTTTCTCCAATGGG - Intronic
1100837076 12:98576588-98576610 CCTTCACCCACTTTTTCATGGGG + Intergenic
1101530111 12:105566070-105566092 CCTTCACCTTTTTATTTCAGAGG - Intergenic
1102412689 12:112733832-112733854 CCTTCTACCTTTTCCTCATGTGG + Intronic
1103960478 12:124606203-124606225 GCTTCATTCTTTTCTTCACGAGG + Intergenic
1106334522 13:28771264-28771286 CCTTCACCCTCTTTTTGATGGGG + Intergenic
1107223368 13:38014486-38014508 CCTTCACCTGTTTTTTTAAGTGG + Intergenic
1107257644 13:38447740-38447762 CCTTCACCCATTTTTTAAATTGG + Intergenic
1109565867 13:64115714-64115736 CCTTCACCCCTTTTTTGATGGGG + Intergenic
1109669908 13:65590486-65590508 CCTTCACCCACTTGTTCATGGGG - Intergenic
1110526633 13:76545891-76545913 CCTTCACCCACTTTTTGAAGGGG + Intergenic
1110750793 13:79113284-79113306 CCTTCTCCCTTGTCTTCACATGG + Intergenic
1112819625 13:103316509-103316531 CCTTTTCCCATTTCTGCAAGTGG + Intergenic
1112839613 13:103560232-103560254 CCTTCACCCATTTTTTGATGGGG - Intergenic
1114144680 14:19960805-19960827 GCTTTACCCATTTCTTCATGAGG - Intergenic
1114914727 14:27249019-27249041 CCTTCACCCATTTTTTGATGGGG + Intergenic
1115873944 14:37839468-37839490 CCTTCACCCATTTTTTGATGGGG + Intronic
1116005954 14:39290202-39290224 CCATCAGCCTCTTCTTCTAGGGG + Intronic
1116565825 14:46442972-46442994 CCTTCACCCACTTTTTCAAGGGG - Intergenic
1116801474 14:49448906-49448928 CCATCACTGTTCTCTTCAAGAGG + Intergenic
1117166306 14:53037568-53037590 CCTTCACCCATTTTTTAATGGGG + Intronic
1117612570 14:57499824-57499846 CCTTCACCCATTTTTTGATGGGG + Intergenic
1118484935 14:66205777-66205799 CCTTCACCCATTTTTTGATGGGG - Intergenic
1119931498 14:78551809-78551831 CCTTTTTACTTTTCTTCAAGTGG + Intronic
1120080558 14:80211516-80211538 CCTTCACCCTCTTATTTAAAAGG + Intronic
1122169350 14:99859360-99859382 CCTTCTCCCTTCACTTCCAGCGG + Intronic
1122517862 14:102320960-102320982 CCCTAACCCGTTTCTTCTAGTGG - Intronic
1123226631 15:17042731-17042753 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1124465522 15:29936017-29936039 CCTTCTCCCTCTTCCTCAACTGG + Intronic
1124560008 15:30763459-30763481 TTTTCACACTTTTCTTCATGAGG - Intronic
1124671238 15:31642333-31642355 TTTTCACACTTTTCTTCATGAGG + Intronic
1125148564 15:36503811-36503833 CCTTCACCCTTTTCTTACCTCGG + Intergenic
1125225013 15:37386130-37386152 CCTTCACCCATTTTTTGATGGGG + Intergenic
1126492846 15:49258971-49258993 CCTTCACCCATTTTTTGATGGGG + Intronic
1130484175 15:84388870-84388892 CCTTCACCCATTTTTTGATGGGG + Intergenic
1130975182 15:88768448-88768470 CCTGCATACTTTTCTTAAAGTGG + Intergenic
1133201295 16:4206289-4206311 CCTACAGCCTAGTCTTCAAGGGG + Intronic
1133855810 16:9548238-9548260 CTTTCAACCTTTTCTCCATGTGG + Intergenic
1135260794 16:20978843-20978865 CCTTCACCTTTTTATAGAAGAGG + Intronic
1135307689 16:21381025-21381047 CCTTCACCCTTTGAGTCAAAGGG - Intergenic
1135622833 16:23970550-23970572 CCTTCCCATTTTTCTTCAAAGGG + Intronic
1135972260 16:27081103-27081125 CCTTCACCATTTTCTCCACCAGG + Intergenic
1136609754 16:31359123-31359145 CCTTCACTCTTTTGTTGATGGGG + Intronic
1137978582 16:53051316-53051338 TGTTCACCCTTTTCTTCAAAGGG - Intergenic
1138094805 16:54203202-54203224 CCTTCTCCCTCTCCTTCATGGGG - Intergenic
1138843180 16:60534123-60534145 CCTTCACCCATTTTTTGATGGGG + Intergenic
1139208650 16:65054363-65054385 CCTTGAGCCTGTTGTTCAAGAGG - Intronic
1139229951 16:65274016-65274038 CCTTCATCCTGTTATTCCAGTGG - Intergenic
1139690445 16:68638325-68638347 CCTGCACTCTTTCCTTCCAGAGG - Intronic
1139975281 16:70805049-70805071 CCCTCACCCTACTCTTCAAAAGG - Intergenic
1140976476 16:80064508-80064530 CCTTCCCCCCTTTTTTCAATGGG + Intergenic
1142125998 16:88411001-88411023 CCGTCTCCCTTCTCTTCATGGGG + Intergenic
1145023971 17:19453658-19453680 CTTTCCCCCTTTTGTTCCAGGGG - Intergenic
1146572319 17:33963307-33963329 CACTCACCCTATTCTTCAGGAGG - Intronic
1146775250 17:35608648-35608670 CTTTCATCATTTTCTTCAGGAGG + Intronic
1148517927 17:48239306-48239328 CCTTCCCCTTTTTATTCAGGAGG - Intronic
1150642999 17:66962324-66962346 CCCACACACTTTTCTGCAAGTGG + Intergenic
1150824633 17:68463687-68463709 CCTGCTCCCTTTTCTTCCTGAGG - Intergenic
1150887840 17:69108347-69108369 CCTTGACCATTTTCTTCTTGTGG + Intronic
1151054185 17:71012784-71012806 CCTTCTTCCTTTTCTTCAAGTGG - Intergenic
1151320224 17:73348498-73348520 CTTTCTTCCTTTCCTTCAAGGGG - Intronic
1151921534 17:77159871-77159893 AGTTCACCCTTTTATTTAAGTGG - Intronic
1153373860 18:4353764-4353786 CCTCCACTCTGTTTTTCAAGGGG + Intronic
1154462015 18:14600406-14600428 GCTTTACCCATTTCTTCATGAGG - Intergenic
1155979905 18:32169199-32169221 CCTTCACCCATTTGTTGATGGGG - Intronic
1156034735 18:32753708-32753730 CCTTGGCCCTTTGCTTCATGAGG + Intronic
1156344976 18:36248942-36248964 CGTTCACTATTTTCCTCAAGAGG - Exonic
1157321432 18:46637562-46637584 CCTTCACCTGTTTTTTCAACTGG - Intronic
1158877872 18:61750464-61750486 CCTTCACCCATTTTTTGATGGGG - Intergenic
1159178229 18:64866632-64866654 CCTTCACCCACTTTTTCATGGGG + Intergenic
1160353726 18:78208312-78208334 CATTCACCCTTTTCTTTTTGTGG + Intergenic
1164266071 19:23618818-23618840 CCTTCACCCATTTGTTGATGGGG - Intronic
1164537950 19:29100374-29100396 TATTCCCCCTTTTCTTCAAAAGG - Intergenic
1164716990 19:30399239-30399261 CCTTCACCCACTTTTTCATGGGG + Intronic
1168233687 19:55048761-55048783 CCTCCACCCCTCTCTTCCAGAGG - Exonic
925329099 2:3044567-3044589 CCTTCACCCCTTTCTTTTAATGG - Intergenic
926248136 2:11135951-11135973 CCTTAACCCATTTTTTCAATTGG + Intronic
928486855 2:31740984-31741006 CCTTCACCCACTTTTTGAAGGGG + Intergenic
929459952 2:42096228-42096250 CCTTCCCCCATTTCTTCCATGGG - Intergenic
930270216 2:49247479-49247501 CCTTCACCCATTTTTTTATGGGG - Intergenic
930517915 2:52431724-52431746 CCTTTACCCTTTCCTTCCTGTGG + Intergenic
930862265 2:56087277-56087299 TCTTCCCCCTTTTCTTCACCAGG - Intergenic
930870176 2:56162625-56162647 CCTTCACCCACTTCTTGATGGGG + Intergenic
931207095 2:60158347-60158369 CCTTGTGCCTTTTCTTCAACTGG - Intergenic
931220238 2:60282814-60282836 CCTACTGCCTTTTCTTCAAAGGG - Intergenic
931642263 2:64392314-64392336 CCTTTACCCCTTTCCTCCAGGGG - Intergenic
931699622 2:64899070-64899092 CCTTTACCCTTTCCTTCTTGTGG - Intergenic
932051093 2:68398556-68398578 CCTTCACCCATTTTTTGATGGGG + Intergenic
932263512 2:70346480-70346502 CCTTCACCCTTTCCCCCTAGAGG + Intergenic
932285862 2:70531101-70531123 CCTTCTACCTTTTCTTAGAGGGG - Intronic
933885428 2:86715423-86715445 CTTTCACCCATTTCTTCAACTGG + Intronic
933924748 2:87081268-87081290 CTTTCACCCATTTCTTCAACTGG - Intergenic
936888272 2:117338790-117338812 CCATCATCCCTTTCTCCAAGTGG - Intergenic
937004110 2:118495886-118495908 CCTTCACCCTTTGCCTAAATTGG + Intergenic
937431740 2:121844333-121844355 CCTTCCCCCTTTCTTTCCAGAGG + Intergenic
939417431 2:141917771-141917793 GCTTAACCCTTTTCTTTAAATGG + Intronic
940315778 2:152326115-152326137 TCTTTACCCTTGTCTTCATGTGG - Intergenic
940574208 2:155479106-155479128 CCTTCACCCACTTGTTCATGGGG - Intergenic
942051115 2:172141901-172141923 CCTTCACACTTTTATACAACAGG - Intergenic
942360608 2:175168121-175168143 CGTTCAGCCTTTTCCTCCAGGGG - Exonic
942447789 2:176089703-176089725 TCTTCCTCCTTTTCTTCCAGAGG - Intergenic
942955439 2:181767454-181767476 CCTTCACCCATTTGTTGATGGGG + Intergenic
943549783 2:189324484-189324506 CCTTCACCCACTTCTTGATGGGG - Intergenic
944254322 2:197609455-197609477 CCTTCACCCATTTTTTGATGGGG + Intronic
944344106 2:198639635-198639657 CCTACTTCCTTTTCTTCCAGAGG - Intergenic
944563500 2:200964306-200964328 CCATTACCTTTTTCTTCAAAAGG - Intergenic
944931431 2:204524192-204524214 CCTTCACCTTTTTGTTCTATTGG + Intergenic
945068918 2:205971708-205971730 CCTTAACTGTGTTCTTCAAGGGG - Intergenic
945412855 2:209532983-209533005 CCTTTTCTTTTTTCTTCAAGTGG + Intronic
945567947 2:211427305-211427327 CCACCACCCTTTTATTTAAGTGG + Intronic
946045087 2:216814258-216814280 ACTTCAGCCTTTTTTTCCAGAGG + Intergenic
946193315 2:218019172-218019194 CCTTCACCCTTATCTTCCAGGGG - Intergenic
947146930 2:227076804-227076826 CCTTCACCCACTTTTTGAAGGGG - Intronic
948226044 2:236310062-236310084 CCTACACCCTTTTCTTTGTGAGG - Intergenic
948418937 2:237840736-237840758 CCTTCACCCATTTTTTAATGGGG - Intronic
948465387 2:238149500-238149522 CCGTCACCCCTGTCCTCAAGGGG - Intronic
948534093 2:238633087-238633109 CCCTCACTCTGTACTTCAAGTGG - Intergenic
1170409451 20:16072899-16072921 CCTTCACCCTTTTTCCCAGGTGG - Intergenic
1172628917 20:36365456-36365478 CCTTAACACTTTTATTCAGGTGG + Intronic
1173269537 20:41519989-41520011 CCTTCACCCATTTTTTGATGGGG - Intronic
1174336141 20:49862195-49862217 CCTTCCCCCATTTCTTCACCTGG + Intronic
1176159203 20:63640120-63640142 CCTTCACACTTTACAGCAAGGGG + Exonic
1176812542 21:13558227-13558249 GCTTTACCCATTTCTTCATGAGG + Intergenic
1176879328 21:14172035-14172057 CCTTCACCCATTTTTTGATGGGG - Intronic
1176963090 21:15181675-15181697 CCTTCACCCACTTCTTGATGAGG + Intergenic
1177023751 21:15896028-15896050 CCCACACCCTTCTCCTCAAGTGG - Intergenic
1177591116 21:23169072-23169094 CCTTCACCCTCTTTTTAATGGGG - Intergenic
1177733526 21:25060006-25060028 CCTTAACAGTTTTCTTCAACTGG - Intergenic
1180399306 22:12394154-12394176 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1183714003 22:39522994-39523016 CCTCCACCTGTTTATTCAAGAGG + Intergenic
949332373 3:2936610-2936632 CCTTCTCTCTTTTCTTCAAATGG + Intronic
949618706 3:5785894-5785916 CCTTCACCCATTTTTTGATGGGG - Intergenic
950450984 3:13065490-13065512 CACTCACACTTTTATTCAAGAGG + Intronic
951216434 3:20029741-20029763 CCTTAACTCTTTTTTTAAAGCGG - Intergenic
952074188 3:29675596-29675618 CCTTCACCCATTTTTTGATGGGG - Intronic
952535362 3:34303724-34303746 CCTCCACCCTTTTGTTTCAGCGG - Intergenic
952810105 3:37394540-37394562 CCTTCACCCACTTTTTGAAGGGG + Intronic
954321102 3:49832590-49832612 CCTTCTCCTTTTTCTGCATGTGG - Intronic
954655451 3:52191499-52191521 CCTGCCCCATTATCTTCAAGGGG + Intergenic
955440167 3:58946640-58946662 CCTGCACATTTTTCTTCATGGGG - Intronic
956560974 3:70574173-70574195 GCTTCTGCCTTTTCATCAAGAGG - Intergenic
957865140 3:86013257-86013279 CCTTCACCCTCTTCTTCACTGGG - Intronic
962131439 3:132681974-132681996 CCTTCACGCCATTCATCAAGTGG - Exonic
963092390 3:141496483-141496505 CCTTCACCCACTTTTTCATGGGG - Intronic
963691174 3:148504690-148504712 CCTTCACCCTCTTTTTGATGGGG + Intergenic
964044178 3:152301697-152301719 TCTTCACCCTTTCCTTTGAGAGG + Intronic
966682564 3:182658299-182658321 CCATCAACCTTTTCTTAAAATGG + Intergenic
970893307 4:21072465-21072487 CCTTCACCCTCTTTTTGATGGGG + Intronic
971749250 4:30625006-30625028 CCTTCACCCACTTTTTGAAGGGG + Intergenic
971971724 4:33629839-33629861 CCTTCACCCACTTTTTGAAGGGG - Intergenic
972217768 4:36916422-36916444 CCTTCATCCTTGTGTCCAAGAGG - Intergenic
973106712 4:46348093-46348115 CCTTCACCCATTTTTTGATGGGG - Intronic
974120575 4:57632938-57632960 TCTTGACTCTTTTCTTAAAGTGG + Intergenic
975812236 4:78181604-78181626 CCTTCACCCTTTTCTTCAAGTGG + Intronic
976448644 4:85161470-85161492 CCTTCACCCATTTTTTGATGGGG + Intergenic
976635207 4:87280466-87280488 CCTTCACCAGTTTCTCCAAATGG + Intergenic
977359264 4:95982191-95982213 CCTTCACAGTTGTCTCCAAGTGG + Intergenic
977692613 4:99932328-99932350 CCTTCACCCGTTTTTTTAACCGG - Intronic
978361667 4:107937391-107937413 CATTTACCCTTTTCTTCCATAGG - Intronic
978412043 4:108436243-108436265 CCTTCGCCCATTTGTTCATGGGG + Intergenic
979352139 4:119656469-119656491 CCTTCACCATTTTCTTCATTTGG + Intergenic
979361534 4:119771188-119771210 CCTACCCTCTTTCCTTCAAGTGG - Intergenic
980077098 4:128305507-128305529 CCTTAACCCTTGACTTCAGGAGG - Intergenic
980151173 4:129050556-129050578 CCTTCACCCATTTTTTGATGGGG + Intronic
980490954 4:133527870-133527892 AGTTCACCCTATTCTTTAAGTGG - Intergenic
981100184 4:140821193-140821215 CCTTCACCCATTTGTTGATGGGG + Intergenic
981325000 4:143436286-143436308 TCTCCATCCTATTCTTCAAGAGG - Intronic
982622658 4:157727004-157727026 CCTTCTCCCATTTCTGGAAGAGG + Intergenic
982939230 4:161527463-161527485 CCTTCACCCACTTTTTGAAGGGG - Intronic
983100905 4:163624327-163624349 CCAACACCCATTCCTTCAAGCGG + Intronic
983839414 4:172437973-172437995 TTTTCACTCCTTTCTTCAAGAGG + Intronic
983988728 4:174092558-174092580 CCTTCACCCACTTCTTGATGGGG + Intergenic
987728204 5:21731102-21731124 CCCTCACCCTTTACTTGATGTGG + Intergenic
988662836 5:33292071-33292093 ACTTCAATCTTTTGTTCAAGAGG + Intergenic
989407128 5:41074098-41074120 CCTTCACCCATTTTTTGATGGGG + Intergenic
989527061 5:42465872-42465894 CCTTCACCCCTTTCATCAAGTGG + Intronic
990250660 5:53911535-53911557 CCTTTAACCTTTTTTTCAATAGG + Intronic
990747470 5:58974737-58974759 TCTTCAACCTGTTCATCAAGGGG + Exonic
990842295 5:60095914-60095936 CCTTCACCCTCTTTTTAATGGGG + Intronic
990992919 5:61702575-61702597 ACTTCAAATTTTTCTTCAAGTGG - Intronic
991568489 5:68030058-68030080 CCTTCACCCTTTTCCCCCATAGG - Intergenic
991941150 5:71853331-71853353 CCTTCACCCACTTTTTCATGGGG - Intergenic
992274145 5:75097483-75097505 CCTTCACCCACTTTTTCATGGGG + Intronic
992277605 5:75136332-75136354 CCTTCACCCACTTTTTCATGGGG - Intronic
992544408 5:77797428-77797450 CTTTCACCTTCTTCTTCTAGAGG - Intronic
993328680 5:86570209-86570231 CCTTTACCCTTTCCTTCTTGTGG - Intergenic
993492096 5:88564766-88564788 TATTCACCCTTTTCCTCGAGAGG + Intergenic
993804528 5:92388029-92388051 CCTTCACCCACTTTTTCATGGGG - Intergenic
993963644 5:94333048-94333070 CCTTCACCCGCTTTTTCATGGGG + Intronic
994418415 5:99502938-99502960 CCTTCACCCACTTTTTCATGGGG - Intergenic
994461553 5:100072208-100072230 CCTTCACCCACTTTTTCATGGGG + Intergenic
995276096 5:110279488-110279510 CCTTCACCCACTTCTTGATGGGG + Intergenic
996011568 5:118486429-118486451 CCTCCTCCCTTTTGTTCCAGGGG + Intergenic
996227054 5:121012555-121012577 CCTTCAAACTGTTTTTCAAGTGG - Intergenic
997004009 5:129797520-129797542 CCTTCACCCATTTTTTGATGGGG + Intergenic
998203454 5:140143374-140143396 CCTTCTCCCTCTTCTACAAGGGG - Intergenic
999178028 5:149645727-149645749 CCTTCCCTCTTTTCTTCGAAAGG + Intergenic
999415337 5:151390232-151390254 CCTTCACCCATTTGTTGATGGGG + Intergenic
999572881 5:152940441-152940463 CCTTCACCCACTTCTTGATGGGG - Intergenic
999984477 5:156990055-156990077 CCTTCACCCACTTCTTGATGGGG - Intergenic
1001154622 5:169262412-169262434 CCTTCAGCCTGTCCTTCAACTGG - Intronic
1001179188 5:169502775-169502797 CCATCTCCCTTTTCTTGATGTGG - Intergenic
1001535123 5:172492663-172492685 CCCTCACCCTTTCCTTCCACAGG - Intergenic
1001773120 5:174310520-174310542 CCGTCACCTTTGTCTTCATGTGG + Intergenic
1002180868 5:177430543-177430565 CCTTCTCCCCTTTCTTCACCGGG + Intronic
1004447907 6:15717785-15717807 CTTTCACTTTGTTCTTCAAGAGG + Intergenic
1005426677 6:25710221-25710243 GCTTCACCCCTTTCTGCCAGTGG + Intergenic
1005519894 6:26590412-26590434 CCTTCTACGTTTTCTTCTAGAGG + Intergenic
1005563818 6:27068976-27068998 CCTTCAATCTTTTCTTTACGTGG - Intergenic
1005807303 6:29486924-29486946 CCTTCAGCCTTTTCTTTCTGAGG + Exonic
1006175198 6:32117272-32117294 CTTTAGCCCTTGTCTTCAAGTGG + Intronic
1006734276 6:36261439-36261461 CCTCCTCCCTTTTCCTCATGTGG - Intronic
1008776458 6:55045389-55045411 CCTACACCATTTTCTTGAAAAGG - Intergenic
1008923160 6:56863812-56863834 CCTTCACTCTCTTCCTCAACTGG + Intronic
1009299020 6:61991400-61991422 CATTAAGCCTTTTCTTCATGAGG - Intronic
1010805668 6:80233267-80233289 CCTTAATCCATTTCTTAAAGTGG + Intronic
1012143335 6:95650731-95650753 CCTTCACCCTTGTTTTCATCAGG - Intergenic
1012287391 6:97408444-97408466 CCTTCACCCATTTTTTGATGGGG - Intergenic
1012612285 6:101230898-101230920 CCTTTACCCTTTCCTTCTTGTGG - Intergenic
1012728070 6:102842173-102842195 CCTTCACCCATTTTTTGATGGGG - Intergenic
1014039868 6:116813922-116813944 CCTTCACCCACTTTTTGAAGGGG - Intronic
1014382006 6:120753652-120753674 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1014729061 6:125009261-125009283 CCTTCATCCCTTTCTTGAACTGG - Intronic
1014741038 6:125147763-125147785 GTTGCACCCTTTTCTTCATGTGG + Intronic
1015315645 6:131813330-131813352 GTTTCACCCTTTTTTTGAAGGGG - Intronic
1015387571 6:132642123-132642145 CCTCCACCCTCTTCTCAAAGAGG - Intergenic
1015885063 6:137909572-137909594 CCTTCCCTCTTTTCTTTAAAGGG - Intergenic
1017291505 6:152743666-152743688 CTTTCACCTTTCTCTTCAAGTGG - Intergenic
1018114657 6:160571855-160571877 GCTTCAGCCCTTTCTTCACGGGG + Intronic
1019374468 7:682008-682030 CATTCACCCTTTTCCCAAAGAGG - Intronic
1021300451 7:18966241-18966263 CCTACACGCTTTTCTTAAAAGGG - Intronic
1022147154 7:27555939-27555961 CCTTGCCCTTTCTCTTCAAGGGG + Intronic
1022345772 7:29512904-29512926 CCTTCACCCTTGTTCTCACGTGG - Exonic
1022984213 7:35634734-35634756 CCTGCTCCCTTCTCTCCAAGGGG - Intronic
1023043405 7:36192123-36192145 CCTTCACCCTTTTCTAAAAGAGG + Intronic
1023319981 7:38985260-38985282 CTTTCAACCTTTTCTCCAAAAGG + Intronic
1024332578 7:48170894-48170916 CCTTCACCCATTTCCTCCAAAGG - Intergenic
1024449730 7:49525461-49525483 CCTACCCTCTTTTCTCCAAGTGG + Intergenic
1024514352 7:50232264-50232286 CCTTCACCCATTTTTTGATGGGG + Intergenic
1025892234 7:65663872-65663894 CCTTCACCCACTTTTTCATGGGG + Intergenic
1026389435 7:69885332-69885354 CCTTCACCGATTTATTTAAGAGG - Intronic
1026853331 7:73738089-73738111 CCTGCACCCTTTCCATGAAGGGG - Intronic
1027167511 7:75845907-75845929 CCTTGACCATTTGGTTCAAGTGG - Intronic
1028526488 7:91792204-91792226 CCTTCACCCATTTGTTGATGGGG + Intronic
1029056824 7:97753940-97753962 GCTTCACTCTTTCTTTCAAGAGG - Intergenic
1030922510 7:115409323-115409345 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1031139235 7:117923407-117923429 CCTTCACCCATTTTTTGATGGGG - Intergenic
1031866487 7:127042932-127042954 CCTTCACCCATTTTTTGATGGGG - Intronic
1032882990 7:136109728-136109750 CCTTCACCCTCTTTTTAATGGGG + Intergenic
1033226785 7:139568954-139568976 ATTTCACCCCTTTCTTCAACTGG + Exonic
1033787345 7:144748995-144749017 CTTTCCTCCTTTTTTTCAAGGGG - Intronic
1033872877 7:145778036-145778058 TCTTCAACGTTTACTTCAAGTGG - Intergenic
1035885457 8:3286649-3286671 CCTTCACCCACTTATTGAAGGGG + Intronic
1035969912 8:4236363-4236385 TCTTCACCCCTTTCTCCGAGTGG - Intronic
1037199956 8:16240168-16240190 CCTTCACGCTTTTCTTAAAATGG + Intronic
1037207106 8:16336454-16336476 CCTTCACCCACTTGTTGAAGGGG + Intronic
1037387263 8:18356735-18356757 CCCTTACCCTCTCCTTCAAGGGG - Intergenic
1039145652 8:34443665-34443687 CCTTCACCCATTTTTTGATGGGG - Intergenic
1039552167 8:38451090-38451112 CCTCCACCCTTGTTCTCAAGAGG + Intronic
1040670065 8:49679207-49679229 CCTTCACCCGCTTTTTGAAGGGG - Intergenic
1040827882 8:51643858-51643880 CCTTCACCCATTTTTTGATGGGG - Intronic
1041762980 8:61386852-61386874 CCTACACCCCTTTCATTAAGTGG + Intronic
1041817702 8:61993796-61993818 CCTTCACCCATTTTTTGATGGGG - Intergenic
1042313563 8:67401781-67401803 CATTCACCCTTATCTTGGAGTGG - Intergenic
1042348977 8:67757029-67757051 CCTTCACCCACTTTTTCATGGGG - Intergenic
1042638138 8:70901481-70901503 CCTTCACCCACTTTTTGAAGGGG + Intergenic
1042821055 8:72930619-72930641 CCTTCACCCATTTGTTGATGGGG + Intronic
1043303296 8:78761987-78762009 CCTTCACCCTCTTCTTCGCTGGG + Intronic
1043352232 8:79375435-79375457 CCTACACTCATTTCTTAAAGAGG + Intergenic
1043608493 8:82031755-82031777 CCTTCACCCATTTTTTCATTGGG + Intergenic
1044284143 8:90392072-90392094 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1044971349 8:97623240-97623262 CCTCCATCCTTTTCTTAAATTGG - Intergenic
1046120270 8:109837673-109837695 CCTTCACCCATTTTTTGATGGGG - Intergenic
1047242780 8:123108092-123108114 CCTTCACCCTTCTCTTACATTGG + Intronic
1047862229 8:128980317-128980339 GCTTCACCATTTCCTTTAAGGGG + Intergenic
1048919062 8:139211285-139211307 CCTGCATCCTCTTCTCCAAGGGG + Intergenic
1052323340 9:27191803-27191825 CCATCACCTTTGTCTACAAGTGG + Intronic
1052563209 9:30112049-30112071 CCTTCACCCACTTTTTCATGGGG - Intergenic
1055172694 9:73279381-73279403 CCTTCACCTTTTTCAACTAGTGG - Intergenic
1055585332 9:77753312-77753334 CCTGAACCTTTTTCTTCAGGGGG - Intronic
1056069637 9:82972856-82972878 TGGTCACCCTTTTCTTTAAGGGG - Intergenic
1056964444 9:91154396-91154418 TCTTCATCCCTGTCTTCAAGTGG + Intergenic
1058215398 9:102226791-102226813 CCTTCACCCAGTTCTTCACAGGG + Intergenic
1058231747 9:102434886-102434908 CCTTTAACCTTTTGTTTAAGTGG + Intergenic
1058548495 9:106087107-106087129 CCTTCACCCACTTCTTGATGGGG + Intergenic
1058815431 9:108678567-108678589 CAGTCACCCTTGACTTCAAGGGG + Intergenic
1059684695 9:116623743-116623765 CCTGCACGCTTTTCTGTAAGTGG - Intronic
1060387225 9:123242058-123242080 TCTTCTCCCTTTTCTTCAAAAGG + Intronic
1062703745 9:137922761-137922783 CCTTTACCCTTTTCTCCCAGTGG + Intronic
1203400936 Un_KI270519v1:96596-96618 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1186281785 X:8000902-8000924 CCATCTCTCTTTTCTTCAAATGG + Intergenic
1186385742 X:9108660-9108682 CCTTCACCCATTTTTTAATGTGG + Intronic
1187926572 X:24256155-24256177 CCTTCACCCTTCACGTCAGGAGG - Intergenic
1187946159 X:24428084-24428106 CTTTGACACTTTTCTTTAAGTGG - Intergenic
1188058930 X:25576705-25576727 CCTTCACCCTTCACTTTCAGAGG - Intergenic
1188447939 X:30276338-30276360 CCTTCAACCTTTGGTTCATGGGG - Intergenic
1189177643 X:38973934-38973956 CCATTACCTTTCTCTTCAAGTGG - Intergenic
1189367603 X:40401054-40401076 CCTTCAACCCTTTCAGCAAGAGG + Intergenic
1189609939 X:42721572-42721594 CCTTCACCCATTTTTTGATGGGG + Intergenic
1189865596 X:45323815-45323837 CCTTCCCACTCTTCTACAAGTGG + Intergenic
1190023896 X:46904271-46904293 CTTTCACCCTTATCTGCCAGTGG + Intergenic
1190654798 X:52601897-52601919 CCTTCACCCATTTTTTGATGGGG - Intergenic
1190780492 X:53589914-53589936 CCCTCAACCTTCTCCTCAAGCGG + Intronic
1191597495 X:62961536-62961558 CCTTCACCCACTTTTTCATGGGG + Intergenic
1191610625 X:63108223-63108245 CCTTCACCCATTTGTTGATGGGG - Intergenic
1191789436 X:64953490-64953512 CCTTCACCCACTTGTTGAAGGGG - Intronic
1191948717 X:66564621-66564643 CCTTCACCCACTTTTTCATGGGG + Intergenic
1192028861 X:67487810-67487832 CCTTCACCCATTTTTTTATGGGG - Intergenic
1192162190 X:68796754-68796776 CCTTCACCCTCTCCACCAAGGGG + Intergenic
1192253046 X:69429466-69429488 CCTTCAACCTTTTCACAAAGGGG - Intergenic
1192734021 X:73831363-73831385 TTTTTACCCTTTTCTTCATGTGG + Intergenic
1192758730 X:74072823-74072845 CCTTCACCCACTTTTTCATGGGG + Intergenic
1192792730 X:74399126-74399148 CCTTCACTCTCTTCTTCACTGGG + Intergenic
1193181797 X:78467046-78467068 CCTTCACCCACTTCTTCATGGGG + Intergenic
1193487554 X:82104949-82104971 CCTTCACCCATTTTTTGATGGGG + Intergenic
1193685919 X:84576850-84576872 CCTTCACCCATTTTTTGATGGGG - Intergenic
1194106780 X:89779393-89779415 CAGTCTCCCTTTTATTCAAGGGG - Intergenic
1194836996 X:98693967-98693989 CCTTCACCCATTTTTTGATGGGG + Intergenic
1195307927 X:103603897-103603919 CCTTTAGCTCTTTCTTCAAGTGG + Intergenic
1195593039 X:106654357-106654379 CCTTCACCCACTTCTTGATGGGG + Intronic
1196064819 X:111452342-111452364 CTTTCACCCTCTTCTCCATGTGG - Intergenic
1196630766 X:117936789-117936811 CCTTCTCCATTTACCTCAAGTGG + Intronic
1197302503 X:124798513-124798535 CCTTCACCCTCTTTTTGATGGGG + Intronic
1197678514 X:129357120-129357142 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1199254658 X:145705378-145705400 CCTTCACCCACTTTTTGAAGGGG - Intergenic
1199563411 X:149188107-149188129 CCTTAACCCTTTTTTTCATAAGG + Intergenic
1200378953 X:155814130-155814152 CCTTCACCCTCTTTTTGATGGGG - Intergenic
1200532148 Y:4352369-4352391 CCTTCACCCACTTTTTCATGGGG - Intergenic
1201389714 Y:13484173-13484195 CCTTCACCCATTTTTTGATGGGG + Intergenic
1201925952 Y:19288114-19288136 CCTTCACCCACTTTTTCATGGGG - Intergenic
1202373906 Y:24216423-24216445 CCTTCACCCATTTTTTGATGGGG - Intergenic
1202496875 Y:25453697-25453719 CCTTCACCCATTTTTTGATGGGG + Intergenic