ID: 908751281

View in Genome Browser
Species Human (GRCh38)
Location 1:67426180-67426202
Sequence TTTTCGAATCTTCGTTCACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908751279_908751281 -5 Left 908751279 1:67426162-67426184 CCCTTTTCTTCAAGTGGCTTTTC 0: 3
1: 2
2: 3
3: 54
4: 506
Right 908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG 0: 1
1: 1
2: 2
3: 5
4: 43
908751280_908751281 -6 Left 908751280 1:67426163-67426185 CCTTTTCTTCAAGTGGCTTTTCG 0: 2
1: 2
2: 4
3: 20
4: 236
Right 908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG 0: 1
1: 1
2: 2
3: 5
4: 43
908751276_908751281 4 Left 908751276 1:67426153-67426175 CCTCCTTCACCCTTTTCTTCAAG 0: 3
1: 1
2: 5
3: 45
4: 470
Right 908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG 0: 1
1: 1
2: 2
3: 5
4: 43
908751277_908751281 1 Left 908751277 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG 0: 2
1: 2
2: 2
3: 32
4: 322
Right 908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG 0: 1
1: 1
2: 2
3: 5
4: 43
908751275_908751281 23 Left 908751275 1:67426134-67426156 CCTATCAACTGAAAATTCGCCTC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG 0: 1
1: 1
2: 2
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908751281 Original CRISPR TTTTCGAATCTTCGTTCACG AGG Exonic
904854260 1:33484922-33484944 TTTTTGCATCTTTGTTCATGAGG + Intronic
908751281 1:67426180-67426202 TTTTCGAATCTTCGTTCACGAGG + Exonic
909823239 1:80092839-80092861 TTTTCAAATCTTTGTTCTAGAGG + Intergenic
919478285 1:198055715-198055737 TTTTTGAATCTTCTTTCATAGGG + Intergenic
1080282335 11:30571936-30571958 TTTTCTAAACTTCTTTCATGGGG - Intronic
1089026694 11:115278199-115278221 TTTTCTCATCTTAGTTCACAGGG - Intronic
1090866367 11:130704241-130704263 TTTTCTAATCTTCATTCCCTGGG - Intronic
1091247256 11:134108498-134108520 TTTTTGCATCTATGTTCACGAGG - Intronic
1094719656 12:33051238-33051260 TTTTCAAATCTTCGTTACTGAGG - Intergenic
1098371515 12:69765557-69765579 TTTTTGAATCTGTGTTCACCAGG + Intronic
1110400542 13:75085517-75085539 ATTTTGAGTCTTTGTTCACGAGG - Intergenic
1111120288 13:83839788-83839810 TTTTCAAATCTTAGTTCCCTGGG - Intergenic
1136371782 16:29841253-29841275 TTCTAGAATCTTCCTTCATGGGG - Intronic
1139029157 16:62858408-62858430 TTTTCCAATCGTCCTTCAAGAGG + Intergenic
1151054183 17:71012760-71012782 TTTTCAAATCTTCGCTCATGAGG - Intergenic
1168040179 19:53752345-53752367 TGTTGGAATCTTCCTTGACGAGG - Intergenic
927228419 2:20794469-20794491 TTTTTCCATCTTTGTTCACGAGG - Intronic
928604236 2:32929065-32929087 TTTTCACATCTTCATTCACTGGG + Intergenic
931517748 2:63059681-63059703 TTTTCGAAGCCTCGTTCCCCGGG - Intergenic
931656996 2:64518349-64518371 TCTTCGAGTCTTCATTCAAGTGG - Intergenic
935186402 2:100737556-100737578 TTTTTGAATCTATGTTCATGAGG - Intergenic
937599586 2:123715361-123715383 TTTTTGCATCTACGTTCAGGAGG - Intergenic
943148991 2:184085825-184085847 TTTTTGGATCTTAGTTCATGAGG + Intergenic
943444698 2:187970298-187970320 TTTTTGCATCTACGTTCAAGAGG - Intergenic
945722281 2:213432823-213432845 TTTTTGTATCTTTGTTCACTCGG - Intronic
1170785705 20:19465428-19465450 TTTACTAATGTTCTTTCACGTGG + Intronic
951724069 3:25736348-25736370 TTTTCCAATCTCCTTTAACGTGG + Intronic
952232888 3:31449209-31449231 TTTTTGAATTTTCCTTCACTGGG - Intergenic
953806270 3:46071531-46071553 TTTTTGTATCTATGTTCACGGGG - Intergenic
954781453 3:53064997-53065019 TTTTCAAATCTTCGTTCATGAGG + Intronic
955242577 3:57192059-57192081 TTTTTGCATCTTCGTTAATGAGG + Intergenic
956595141 3:70959207-70959229 TTTTCCAATCTTCATTCTCGGGG + Exonic
965012656 3:163114790-163114812 TTTTCGAATATGTGTTCAAGTGG + Intergenic
973255906 4:48113138-48113160 TTTTAGAGTCTTCATTCATGAGG - Intronic
975812239 4:78181628-78181650 TTTTCGAATCTTCGTTCACAAGG + Intronic
989527065 5:42465896-42465918 TTTTCAAGTCTTCGTTCACAAGG + Intronic
1000508664 5:162154093-162154115 TGTTCGAATCTTCATGCATGAGG - Exonic
1008041278 6:46801406-46801428 TTTTTGTATCTTCTTTTACGAGG + Intronic
1010583098 6:77623548-77623570 TTTTTGAATCTACTTTCACCTGG - Intergenic
1023566533 7:41528745-41528767 TTGTCGAATTATAGTTCACGTGG - Intergenic
1024808195 7:53174574-53174596 TTTTTGCATCTACGTTCACTAGG + Intergenic
1032779626 7:135153760-135153782 TTTTTGCATCTACGTTCACAGGG + Intronic
1033355435 7:140595305-140595327 TTTTAAAATATTCATTCACGGGG - Intronic
1038206722 8:25474213-25474235 TTTTTGCATCTTTGTTCACCAGG + Intronic
1043053838 8:75412629-75412651 ATTTTGAATCTTTGTTCCCGTGG + Intronic
1055019746 9:71656981-71657003 TTTTTGAATCTTGGTTCATTCGG + Intergenic
1190983368 X:55478083-55478105 TTTTTGGATCTTGGTTCATGAGG + Intergenic
1190985331 X:55495100-55495122 TTTTTGGATCTTGGTTCATGAGG - Intergenic
1192160669 X:68784302-68784324 TTTTCAAATCTTCGTTCACAAGG - Intergenic
1194249832 X:91561184-91561206 TTTTCAAATCTTCCTTCATGAGG + Intergenic
1200568796 Y:4802434-4802456 TTTTCAAATCTTCCTTCATGAGG + Intergenic
1201260159 Y:12151078-12151100 TTTTATAATCTTTGTTAACGAGG + Intergenic