ID: 908751282

View in Genome Browser
Species Human (GRCh38)
Location 1:67426183-67426205
Sequence TCGAATCTTCGTTCACGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 13}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908751276_908751282 7 Left 908751276 1:67426153-67426175 CCTCCTTCACCCTTTTCTTCAAG 0: 3
1: 1
2: 5
3: 45
4: 470
Right 908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG 0: 1
1: 1
2: 2
3: 4
4: 13
908751280_908751282 -3 Left 908751280 1:67426163-67426185 CCTTTTCTTCAAGTGGCTTTTCG 0: 2
1: 2
2: 4
3: 20
4: 236
Right 908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG 0: 1
1: 1
2: 2
3: 4
4: 13
908751279_908751282 -2 Left 908751279 1:67426162-67426184 CCCTTTTCTTCAAGTGGCTTTTC 0: 3
1: 2
2: 3
3: 54
4: 506
Right 908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG 0: 1
1: 1
2: 2
3: 4
4: 13
908751275_908751282 26 Left 908751275 1:67426134-67426156 CCTATCAACTGAAAATTCGCCTC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG 0: 1
1: 1
2: 2
3: 4
4: 13
908751277_908751282 4 Left 908751277 1:67426156-67426178 CCTTCACCCTTTTCTTCAAGTGG 0: 2
1: 2
2: 2
3: 32
4: 322
Right 908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG 0: 1
1: 1
2: 2
3: 4
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908751282 Original CRISPR TCGAATCTTCGTTCACGAGG TGG Exonic
908751282 1:67426183-67426205 TCGAATCTTCGTTCACGAGGTGG + Exonic
1072516676 10:96190207-96190229 TCGAATCTTCCATCAGGTGGCGG + Intronic
1088066538 11:105726655-105726677 TGGAAGCTTCGTTCCAGAGGGGG - Intronic
1099601655 12:84747107-84747129 TCTTATCTTCCTTCACAAGGTGG + Intergenic
1109834142 13:67832734-67832756 TCGAATCTTCCATCGCGTGGCGG + Intergenic
1116482515 14:45408725-45408747 TCGAATCTTGGTGCAAGGGGAGG + Intergenic
1131418782 15:92285818-92285840 TCGAATCTTCCATCAGGTGGCGG - Intergenic
1138423105 16:56912679-56912701 TAGAATGTTCGCTCACAAGGAGG - Intronic
1139933374 16:70548221-70548243 TAGATTCTTCTTTCACTAGGTGG + Intronic
1151054182 17:71012757-71012779 TCAAATCTTCGCTCATGAGGTGG - Intergenic
1151397670 17:73834855-73834877 TCGAATCTTCGATTACGGTGTGG + Intergenic
1183830966 22:40418237-40418259 TTTAATCTTCCTTCACCAGGGGG - Intronic
954781454 3:53065000-53065022 TCAAATCTTCGTTCATGAGGTGG + Intronic
975812240 4:78181631-78181653 TCGAATCTTCGTTCACAAGGTGG + Intronic
989527066 5:42465899-42465921 TCAAGTCTTCGTTCACAAGGTGG + Intronic
993400754 5:87447603-87447625 TTGATTCTTCCTTCAAGAGGTGG + Intergenic
1062517868 9:136945158-136945180 TCGAAGCTAGGCTCACGAGGAGG + Intronic
1192160668 X:68784299-68784321 TCAAATCTTCGTTCACAAGGTGG - Intergenic
1194249833 X:91561187-91561209 TCAAATCTTCCTTCATGAGGTGG + Intergenic
1200568797 Y:4802437-4802459 TCAAATCTTCCTTCATGAGGTGG + Intergenic
1201260160 Y:12151081-12151103 TATAATCTTTGTTAACGAGGAGG + Intergenic