ID: 908768572

View in Genome Browser
Species Human (GRCh38)
Location 1:67575407-67575429
Sequence TACCTAAGACTGGTACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908768572_908768580 22 Left 908768572 1:67575407-67575429 CCACTCTGTACCAGTCTTAGGTA No data
Right 908768580 1:67575452-67575474 ATACAAAATCCAGTAGGCCCTGG No data
908768572_908768579 16 Left 908768572 1:67575407-67575429 CCACTCTGTACCAGTCTTAGGTA No data
Right 908768579 1:67575446-67575468 CCAGAGATACAAAATCCAGTAGG No data
908768572_908768574 -10 Left 908768572 1:67575407-67575429 CCACTCTGTACCAGTCTTAGGTA No data
Right 908768574 1:67575420-67575442 GTCTTAGGTACACATTGTGATGG No data
908768572_908768575 -9 Left 908768572 1:67575407-67575429 CCACTCTGTACCAGTCTTAGGTA No data
Right 908768575 1:67575421-67575443 TCTTAGGTACACATTGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908768572 Original CRISPR TACCTAAGACTGGTACAGAG TGG (reversed) Intergenic
No off target data available for this crispr