ID: 908771502

View in Genome Browser
Species Human (GRCh38)
Location 1:67600994-67601016
Sequence GGAAATAACAAGTGTCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908771502_908771507 30 Left 908771502 1:67600994-67601016 CCTTGCTGACACTTGTTATTTCC No data
Right 908771507 1:67601047-67601069 GGATGTGAGGTGATATCTCATGG No data
908771502_908771504 9 Left 908771502 1:67600994-67601016 CCTTGCTGACACTTGTTATTTCC No data
Right 908771504 1:67601026-67601048 TTTTGATATAGCCATACTAGTGG No data
908771502_908771505 17 Left 908771502 1:67600994-67601016 CCTTGCTGACACTTGTTATTTCC No data
Right 908771505 1:67601034-67601056 TAGCCATACTAGTGGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908771502 Original CRISPR GGAAATAACAAGTGTCAGCA AGG (reversed) Intergenic
No off target data available for this crispr