ID: 908777351

View in Genome Browser
Species Human (GRCh38)
Location 1:67653379-67653401
Sequence CACAGTAACAAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908777351_908777356 5 Left 908777351 1:67653379-67653401 CCTTCTTCCCTCTTGTTACTGTG No data
Right 908777356 1:67653407-67653429 AGGGACCCTCCCACCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908777351 Original CRISPR CACAGTAACAAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr