ID: 908780694

View in Genome Browser
Species Human (GRCh38)
Location 1:67686560-67686582
Sequence CCCGGACCTGCACTGCGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908780683_908780694 17 Left 908780683 1:67686520-67686542 CCGACGCTGGCCCCGCGGCGAGC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 119
908780688_908780694 5 Left 908780688 1:67686532-67686554 CCGCGGCGAGCGAGGGCGCCGAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 119
908780686_908780694 7 Left 908780686 1:67686530-67686552 CCCCGCGGCGAGCGAGGGCGCCG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 119
908780687_908780694 6 Left 908780687 1:67686531-67686553 CCCGCGGCGAGCGAGGGCGCCGA 0: 1
1: 0
2: 1
3: 8
4: 62
Right 908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908780694 Original CRISPR CCCGGACCTGCACTGCGTGC TGG Exonic
900177649 1:1297933-1297955 CCCGCCCCTCCACTGCCTGCAGG - Exonic
900598059 1:3491342-3491364 CCGGCACCTGCGCTGGGTGCCGG - Intronic
900608605 1:3534981-3535003 CCCAGTCCTGCACTGGGTACTGG - Intronic
908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG + Exonic
910243092 1:85109578-85109600 CCTGGGCCTGCACTGCATCCTGG - Intronic
917979012 1:180258053-180258075 CCAGGTCCTGCTCTGGGTGCTGG + Intronic
918357255 1:183716870-183716892 CCAGGACCTTCACTGCATCCAGG - Intronic
919613163 1:199772123-199772145 CCCCTACCTGCACAGTGTGCTGG - Intergenic
922784549 1:228276475-228276497 CCCGTGCCTCCACTGCCTGCAGG - Exonic
922787587 1:228290633-228290655 CCCGGACATGCCCTGCATGCAGG - Intronic
923144036 1:231185446-231185468 CCTGGTCCTGCACTGGGGGCTGG - Intronic
923506499 1:234609895-234609917 CCCCGCCCCGCACTCCGTGCCGG - Intergenic
924118465 1:240771575-240771597 CCCGCCCCTGCCCTGCGCGCTGG - Intergenic
1069819472 10:71218474-71218496 CCCACACCTGCACTGTGAGCAGG + Intronic
1070751064 10:78964171-78964193 CCCGCCCCTTCACTGCCTGCTGG + Intergenic
1073249722 10:102114327-102114349 CCCGGGCCTGATCTGCGGGCTGG - Intronic
1076406888 10:130218482-130218504 ACAGGACCTGCTCTGTGTGCTGG + Intergenic
1076995652 11:296364-296386 CCCGGCACTGGACTGCATGCCGG - Intergenic
1077537925 11:3133411-3133433 CACTGCCCTGCACTGCCTGCGGG + Intronic
1083302218 11:61745211-61745233 CCCAGGCCTGCCCTGCCTGCTGG + Exonic
1083304783 11:61756597-61756619 CCCTGCCCTGCACTGGGTGCTGG - Intronic
1083322748 11:61857363-61857385 CCAGGCCCAGCACTGAGTGCAGG - Intronic
1083692530 11:64419123-64419145 TCCGGCCCAGCACTGCGTGTGGG - Intergenic
1083899629 11:65637280-65637302 CCTGGGCCTGCACTGCCTGCAGG + Exonic
1085969286 11:81567497-81567519 CTCTGCCCTGCACTTCGTGCTGG + Intergenic
1089282328 11:117382968-117382990 CCCTGACCTCCACTGCGTGTGGG + Intronic
1089712670 11:120327184-120327206 CCAGGAACTGCACTCCGAGCTGG - Exonic
1090805013 11:130197510-130197532 CCCTGCCCTGCCCTGTGTGCTGG - Intronic
1092252427 12:6907364-6907386 CCCGAAGCTCCACTGTGTGCAGG - Exonic
1096072433 12:48782759-48782781 CCCCGACCTGCACTGCCGCCAGG + Exonic
1097166483 12:57089009-57089031 CCCGGAGCTGCGCTGGCTGCCGG - Exonic
1098298396 12:69028129-69028151 CCTGGCACTGCACTGGGTGCTGG + Intergenic
1101997222 12:109533941-109533963 CCTGGACGTGCACAGCCTGCTGG - Intronic
1102853912 12:116277347-116277369 CCCGGGCCGGCGCTGCGGGCCGG + Intergenic
1103621587 12:122190286-122190308 CCTGGCCCAGCTCTGCGTGCTGG + Exonic
1104967295 12:132514019-132514041 CCAGGCCCTGCCCTGCGTGTTGG + Intronic
1107820485 13:44281334-44281356 CCAGGACCAGCTCTGCATGCAGG - Intergenic
1108689452 13:52848124-52848146 CCAGGCCCCGCAGTGCGTGCTGG - Exonic
1108727616 13:53200292-53200314 CCAGGCCCCGCAGTGCGTGCTGG + Intergenic
1115761971 14:36584028-36584050 CCCGGAGCTGCACCGCGCGCTGG + Intergenic
1117486817 14:56205801-56205823 CCTGACCCTGCACTGGGTGCTGG + Intronic
1118776874 14:68978881-68978903 CCCCGACCCGCTCTGCCTGCCGG - Intronic
1120789080 14:88562973-88562995 CCCCGGCCGGCACTGCGCGCCGG - Exonic
1202861901 14_GL000225v1_random:88810-88832 ACCGGACCCGCACAGCGTCCGGG - Intergenic
1123539178 15:21270657-21270679 CCAGGACCTGCTCTGCCTGTGGG + Intergenic
1128917015 15:71572463-71572485 CTGGGAACTGCACTGCATGCTGG + Intronic
1129192241 15:73944321-73944343 CCCGGACCTGCGCTCCCAGCTGG + Intronic
1136626746 16:31466322-31466344 TCCCGACCTGCACTTCCTGCTGG + Exonic
1137788123 16:51153215-51153237 TCCGGACCTGTACTGCGCTCCGG + Intergenic
1139924382 16:70478183-70478205 CCCGGCCCTGCACCCCTTGCTGG - Intronic
1141033680 16:80610729-80610751 CCCGGCCCTGCAAAGTGTGCTGG - Intronic
1142169260 16:88612009-88612031 CCCGGCCCTCCCCTGCATGCTGG - Intronic
1143029226 17:3958350-3958372 CCAGGAGCTGCTCTGGGTGCTGG - Intronic
1143619479 17:8072911-8072933 CCCGGACATTCACTTCGTGGAGG - Exonic
1147726022 17:42566712-42566734 ACCGGACCTGCACTGCTGGCCGG - Intergenic
1148148132 17:45378938-45378960 CCCGGCCCTGCCCTGCCTGCTGG + Intergenic
1150621612 17:66812030-66812052 CCCTGACCTTCACTCCGGGCTGG + Intergenic
1150782566 17:68134911-68134933 CCAGGATCTGCACGGCCTGCCGG + Intergenic
1151740518 17:75979046-75979068 CCCGGACCTGCGCAGGGAGCGGG - Exonic
1151744719 17:76005730-76005752 CCCTCACCTGCCCTGCCTGCAGG + Exonic
1151975296 17:77480845-77480867 CCAGGCCCTGCTCTGCCTGCGGG - Intronic
1152800231 17:82327402-82327424 CCCCGACCTGCTCTGGATGCTGG + Intronic
1161401139 19:4066635-4066657 CCCCGCCCTGCACCCCGTGCCGG + Intronic
1161428903 19:4219435-4219457 TCCGGACCTGCACTCCTGGCTGG - Intronic
1161454527 19:4363398-4363420 CCAGGATCTGCACGGCCTGCCGG + Exonic
1162050191 19:8028311-8028333 CCAGGCCCTGCACTGGATGCAGG - Intronic
1163678553 19:18667778-18667800 ACTGGACCTGGACTGCGTGCAGG + Exonic
1163725625 19:18921675-18921697 CCCGGAACTGCTCTGCGATCTGG - Exonic
1165448597 19:35869774-35869796 CCGGGACCCGCAGCGCGTGCTGG + Exonic
925838959 2:7972868-7972890 CCCGCACCTGCCCTGCCTGGGGG + Intergenic
926238783 2:11069325-11069347 GCAGGAGCTGCACTGCGTGGAGG + Intergenic
926736515 2:16077629-16077651 CCCAGGACTGCACTGGGTGCAGG + Intergenic
932562636 2:72887018-72887040 GCAGGCCCTGCACTGGGTGCTGG - Intergenic
933015372 2:77117813-77117835 CCTGGACCTGCTCTAGGTGCTGG + Intronic
933212357 2:79585684-79585706 CCCTGGCCTGCACTCCATGCTGG + Intronic
933442087 2:82326468-82326490 CCCGGGCCTGCAGTGCCGGCTGG + Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
938077000 2:128345466-128345488 CCCTCACCTTCACTGCGTGAGGG - Intergenic
941396407 2:164979261-164979283 CCAGGACCTGCTCTGCCTGTGGG + Intergenic
948941637 2:241199800-241199822 GCCTGACCCTCACTGCGTGCGGG + Intronic
1169029526 20:2396784-2396806 CCAGGGCCTGCACTGGGTCCTGG + Intronic
1172095177 20:32456990-32457012 CCCGAATCTGCGCTCCGTGCAGG + Intronic
1175972743 20:62695105-62695127 CCTGCACCTGCTCTGCGTCCTGG + Intergenic
1176056961 20:63154054-63154076 CCCACACCTGCACCGCGTACAGG + Intergenic
1181033890 22:20160868-20160890 CCTGGCCCTGCACTGGGTGAGGG - Intergenic
1181275823 22:21686977-21686999 CCTGGAGCTGCACTGCGACCTGG + Exonic
1181464328 22:23102606-23102628 CCCACACCTGCTCTGCCTGCAGG + Intronic
1181509464 22:23382535-23382557 CCTGGCCCTGCACTGCGTGAGGG + Intergenic
1184362105 22:44024722-44024744 CCCGCGCCTGCTCTGCCTGCCGG + Intronic
1184690112 22:46113658-46113680 CCCGGCCTTGCACTGCGGGAGGG - Intronic
1184754670 22:46509110-46509132 CCAGGGCCTGCACTGAGTGAGGG + Intronic
1185158985 22:49211444-49211466 CCCTGACCTGCCCTGGGAGCTGG - Intergenic
950536645 3:13582756-13582778 CCCGGAGCAGCACTCTGTGCTGG - Intronic
954649741 3:52153923-52153945 CCCGGGCCTGCAGTGTGAGCGGG - Intronic
954789185 3:53118299-53118321 CTCGGACCTGCTCTGGGGGCAGG + Intronic
956129495 3:66039788-66039810 CGCGGACATGCCCTGCGTCCTGG + Intergenic
964509775 3:157437868-157437890 CCCAGCCCTGCACCGCGTGCAGG - Exonic
966465319 3:180225246-180225268 CCCTGCCCTGCCCTGCCTGCAGG - Intergenic
966852263 3:184171434-184171456 CCCATGCCTGCCCTGCGTGCTGG + Exonic
968697689 4:2041022-2041044 CCGGGTCCTGCACGGCGAGCGGG + Intronic
972937917 4:44162089-44162111 CCCACACCTGCAATGCTTGCTGG + Intergenic
982164880 4:152605271-152605293 CCTGAACCTGAACTGTGTGCTGG - Intergenic
983530679 4:168806988-168807010 CCCGGAGCTGTGCTGGGTGCTGG + Intronic
984947930 4:184984152-184984174 CCCGCACCTGCACTCCGGGAAGG + Intergenic
985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG + Exonic
998430778 5:142068136-142068158 CCCAGACCTGCCCTTCCTGCAGG + Intergenic
1002277531 5:178113656-178113678 CTCGGGCCGGGACTGCGTGCCGG - Exonic
1002440024 5:179259411-179259433 CCCGGTCCTGCTGTGCGTGCCGG + Intronic
1013367101 6:109444791-109444813 CCCTGACCTCCACAGGGTGCAGG - Exonic
1014254634 6:119148519-119148541 CCCGCCCCTGCTCTGCCTGCAGG + Intronic
1018814793 6:167322576-167322598 CCATGACCTGCTCTGGGTGCTGG - Intergenic
1019028952 6:168994302-168994324 CCAGGACCTGCCCTGTGTGCGGG - Intergenic
1019176619 6:170162486-170162508 CCCTGACCTGGACCACGTGCTGG + Intergenic
1019637523 7:2083982-2084004 ACCGGACCTTCACTGGGTGGGGG - Intronic
1019640942 7:2103321-2103343 CCCAGGCCTTCACTGAGTGCAGG - Intronic
1019802809 7:3100811-3100833 CCCGGCCCTGCAGTGTTTGCTGG - Intergenic
1023417777 7:39949338-39949360 CCGGAACCGGCACTGCGCGCTGG + Intergenic
1029543602 7:101198785-101198807 CCCGGATCGGAACTACGTGCTGG - Exonic
1034090837 7:148362600-148362622 CCTGCATCTGTACTGCGTGCAGG + Intronic
1035460721 7:159036959-159036981 CCTGGAGCGGCACTGCCTGCTGG - Intronic
1037876596 8:22551751-22551773 CTCGGATCTGGACTGCGGGCCGG - Exonic
1040060919 8:43102218-43102240 CCCAGCCCTGCAGTGGGTGCTGG - Intronic
1041020530 8:53633741-53633763 CCGGGACATACACTGCATGCTGG - Intergenic
1045327186 8:101126269-101126291 GACGGACCTGCACTGGGTGAGGG + Intergenic
1048751825 8:137685839-137685861 CCAGGACCTGTACTAGGTGCTGG - Intergenic
1053600567 9:39604497-39604519 CCCGGCCCTGCACAGCGCCCTGG - Intergenic
1053858215 9:42358352-42358374 CCCGGCCCTGCACAGCGCCCTGG - Intergenic
1054252962 9:62737887-62737909 CCCGGCCCTGCACAGCGCCCTGG + Intergenic
1054567079 9:66772386-66772408 CCCGGCCCTGCACAGCGCCCTGG + Intergenic
1058508797 9:105694364-105694386 CCAGGTCCTGCACTGCGCCCAGG + Intergenic
1197892142 X:131278575-131278597 CCCGGACCTGCTCTGAGGCCGGG + Exonic
1200092833 X:153643887-153643909 CCAGGCCCTGCACTGGGGGCTGG + Intronic
1201264981 Y:12197518-12197540 CAAAGACCTGCACTGCGAGCAGG - Intergenic