ID: 908783941

View in Genome Browser
Species Human (GRCh38)
Location 1:67716730-67716752
Sequence GAATAACAGCAACCCCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908783941_908783943 8 Left 908783941 1:67716730-67716752 CCATTCAGGGGTTGCTGTTATTC 0: 1
1: 0
2: 0
3: 15
4: 135
Right 908783943 1:67716761-67716783 TATCCCCATAGCAAATCAGCAGG No data
908783941_908783947 19 Left 908783941 1:67716730-67716752 CCATTCAGGGGTTGCTGTTATTC 0: 1
1: 0
2: 0
3: 15
4: 135
Right 908783947 1:67716772-67716794 CAAATCAGCAGGAAGCGTGAAGG No data
908783941_908783948 26 Left 908783941 1:67716730-67716752 CCATTCAGGGGTTGCTGTTATTC 0: 1
1: 0
2: 0
3: 15
4: 135
Right 908783948 1:67716779-67716801 GCAGGAAGCGTGAAGGCAAGTGG 0: 1
1: 0
2: 3
3: 18
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908783941 Original CRISPR GAATAACAGCAACCCCTGAA TGG (reversed) Intronic
908731535 1:67231085-67231107 GAATATCTAGAACCCCTGAAAGG + Intronic
908783941 1:67716730-67716752 GAATAACAGCAACCCCTGAATGG - Intronic
908836401 1:68232742-68232764 CATCAACAGCAACCCCTAAATGG - Intronic
911668841 1:100585843-100585865 GAAAGAGAGCATCCCCTGAAGGG + Intergenic
917357646 1:174143425-174143447 GATTCACTGCAACCCCTGGAAGG - Intergenic
917833537 1:178920022-178920044 AAATAAAAGCAAACCCTAAAAGG - Exonic
917879805 1:179323595-179323617 GGATAACAGCAACTGATGAATGG - Intronic
920987596 1:210905078-210905100 GAAGAAGAGCCATCCCTGAAAGG + Intronic
923758851 1:236820492-236820514 AAGTAGCAGCAACCACTGAATGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063890997 10:10628229-10628251 TAAAAACAGTAAACCCTGAAAGG + Intergenic
1065730380 10:28704811-28704833 GGATAAGAAAAACCCCTGAAGGG + Intergenic
1068558116 10:58481685-58481707 TGATAACACCAACCCCAGAAAGG + Intergenic
1069098655 10:64290764-64290786 CAATGACAGACACCCCTGAAGGG + Intergenic
1074890375 10:117730956-117730978 GGATACCAGCAGCTCCTGAATGG + Intergenic
1075240880 10:120777328-120777350 GAAGAACTGCAACCCATGAAGGG - Intergenic
1076432482 10:130415455-130415477 GCATAAAAGCAAAACCTGAAAGG - Intergenic
1077144128 11:1037190-1037212 GAATCCCAGCACCCCCTGAAGGG + Intergenic
1077244790 11:1531300-1531322 GAATAAAATGAACCCCTGCAGGG - Intergenic
1083628886 11:64085813-64085835 GAATAACAGCATCCCCAGCAGGG + Intronic
1085418820 11:76338026-76338048 CAATAAAAGCAATCCTTGAAGGG - Intergenic
1090508611 11:127346955-127346977 GAAGAACAGTCACTCCTGAAAGG - Intergenic
1090963079 11:131574223-131574245 GAATTGCAGCCACCCCTGAATGG - Intronic
1093182621 12:15984087-15984109 GAATAACAGCAGCCACTTATAGG + Intronic
1093953385 12:25189851-25189873 GAATAACAGCTACCCCTTTTAGG - Intronic
1098328740 12:69330891-69330913 GTAAAACAGTAACCTCTGAAGGG - Intergenic
1099362467 12:81721862-81721884 TAATAACATCAACCTCAGAAGGG + Intronic
1099498121 12:83377776-83377798 GAATAACTGGCATCCCTGAAAGG - Intergenic
1102411680 12:112725628-112725650 GAAGAACACCAACCTCTGATTGG - Intronic
1104362599 12:128148209-128148231 GAATAACAGCAAACACATAACGG - Intergenic
1106239614 13:27900425-27900447 GAAGAACAGTAACCCCAGAGAGG + Intergenic
1108343249 13:49518451-49518473 GAAAAACATCAGCCTCTGAATGG - Intronic
1108879418 13:55091220-55091242 AAATAAAAGCAACACCTGAAAGG - Intergenic
1110271641 13:73597717-73597739 TAATAACAGAAAGTCCTGAAAGG + Intergenic
1110866873 13:80406342-80406364 GAATCACTGAAATCCCTGAAAGG - Intergenic
1111864237 13:93747912-93747934 GAATAAGACCCTCCCCTGAAAGG - Intronic
1112628930 13:101139313-101139335 AACTGACAGCAACCCCAGAAGGG - Intronic
1112865284 13:103888504-103888526 GAATAACAACAACCATTAAACGG + Intergenic
1114169393 14:20256535-20256557 GAAAAACATCAAACCCTGAATGG + Intergenic
1114278860 14:21171498-21171520 GACTCACAGGCACCCCTGAAAGG + Intergenic
1114370013 14:22076403-22076425 AAATAACAACAAGCCCTGGATGG - Intergenic
1116411661 14:44631855-44631877 GAATAGCACCAACCCATGAATGG + Intergenic
1117457185 14:55910324-55910346 CAATAACAGCAACCACTTATTGG + Intergenic
1120206296 14:81590657-81590679 AAATAAAAGCAACCCTTGACCGG - Intergenic
1123006887 14:105328073-105328095 GAATAACTGGAACCACTGCAGGG - Intronic
1125374449 15:39013729-39013751 GTAAAACAGTAACCTCTGAAGGG + Intergenic
1129693189 15:77725170-77725192 GAAGGACAGAAAGCCCTGAACGG + Intronic
1138465310 16:57186006-57186028 GAGGAACAGGAAGCCCTGAAGGG - Exonic
1140238175 16:73177615-73177637 GAAACACAGAAACTCCTGAATGG - Intergenic
1141533637 16:84663779-84663801 GAACCACAGTAAACCCTGAAGGG - Intronic
1143543780 17:7584625-7584647 GCATAAAAGCAAGCCTTGAAAGG + Intronic
1143684144 17:8500435-8500457 GAATGTCAGGAACCCCTGAAGGG + Intronic
1143712168 17:8742556-8742578 GAATCACAGGAGCCCCTGAAGGG - Intronic
1145033494 17:19523533-19523555 GAATGACAGCAACCATAGAAAGG - Intronic
1148238040 17:45982564-45982586 GAATAACACCCACACCAGAAGGG + Intronic
1155234564 18:23806382-23806404 AAATCCCAGCAAGCCCTGAAAGG - Intronic
1159986156 18:74843782-74843804 GCATAACAGCAGCCCCTTGAAGG + Intronic
1160554245 18:79715734-79715756 GAGTAACTCCCACCCCTGAATGG - Intronic
1162595325 19:11624528-11624550 GTAAAACAGTAACCTCTGAAGGG - Intergenic
1167071664 19:47225814-47225836 GAGTAAAAGCAACACCTGCAGGG + Intronic
1168469692 19:56630165-56630187 GAAGAACATCAACCCCACAAGGG - Intergenic
928418215 2:31114662-31114684 GAATAACAATAATCCCAGAAGGG + Intronic
931790225 2:65658217-65658239 GAAAAACAACAACCCTTGACAGG - Intergenic
933085625 2:78051470-78051492 GAATCACTGGAATCCCTGAAAGG - Intergenic
933612726 2:84454008-84454030 GAATAACAGCTGCCCCTGGGAGG + Intronic
938889988 2:135694566-135694588 GAAGAACAGTAAACCCTGAGAGG + Intronic
940351837 2:152699564-152699586 GAAGTACAGCAACCCCTTCAGGG + Intronic
941488400 2:166111351-166111373 GTAGAACAGCAAAGCCTGAATGG + Intronic
941526357 2:166611040-166611062 GTAAAACAGTAACCTCTGAAGGG + Intergenic
944981914 2:205130653-205130675 AAATCACAGCAACCCCTGGTGGG + Intronic
945781521 2:214179951-214179973 GAATAACTGCTAACCCAGAATGG - Intronic
947042720 2:225942109-225942131 GTATAAAATCAAACCCTGAAGGG - Intergenic
947177801 2:227384898-227384920 GAATTAGATCAACCCCTGAGGGG - Intergenic
947247091 2:228060911-228060933 GAGGAACAGCAGCCCTTGAAAGG + Intronic
947349440 2:229227487-229227509 GGATAATTGCTACCCCTGAAAGG - Intronic
948347042 2:237307466-237307488 GACTAAAAGCACCCTCTGAATGG + Intergenic
1170920106 20:20670015-20670037 GAATCACAGAAAATCCTGAATGG - Intronic
1174530871 20:51212949-51212971 GAGTATCAGAACCCCCTGAAAGG + Intergenic
1174816531 20:53691932-53691954 CAAAAACAGCAACCCCTGCTTGG - Intergenic
1176268111 20:64221122-64221144 AGATAACAGCAGCCCCTCAAAGG - Intronic
1177362237 21:20087264-20087286 GAATGACAGCAATCCATGATGGG + Intergenic
1185174051 22:49309525-49309547 CAATAACAAAATCCCCTGAAAGG + Intergenic
952042054 3:29272594-29272616 TAATAACAGCTACCAATGAATGG - Intergenic
952961611 3:38594906-38594928 GGAAAAAAGTAACCCCTGAAAGG - Intronic
958120598 3:89282894-89282916 GAATAATAGGAGCCACTGAAAGG + Intronic
962515272 3:136144161-136144183 GGATACCAGCAACACCTAAAAGG + Intronic
964433765 3:156631524-156631546 GAATTAAATCAACACCTGAATGG + Intergenic
965078899 3:164012638-164012660 GGAAAACAGCAACACATGAATGG - Intergenic
965317942 3:167213564-167213586 GAATCACTGGCACCCCTGAAAGG + Intergenic
966508010 3:180728367-180728389 GAATAACAGCAGCTACTTAAAGG - Intronic
975057486 4:69952571-69952593 GAATAATATCAATCCCTGATTGG - Intergenic
980702344 4:136448747-136448769 TGATTACAGCAACCCCTCAATGG + Intergenic
983429328 4:167628453-167628475 CAATAAGAGCAACCACTAAATGG - Intergenic
985349055 4:189038032-189038054 CAACAACAGCAACGCCAGAACGG + Intergenic
988337130 5:29921651-29921673 GAAAAAGAGCAACCCAAGAAAGG + Intergenic
989667342 5:43871025-43871047 GGATAACAGCTACCTCTGAGAGG - Intergenic
990829525 5:59941062-59941084 GAATAATAGCAAGCCCTGGGTGG - Intronic
991224833 5:64258015-64258037 GAATAACAGCAAACTTTGCATGG + Intronic
994511540 5:100709678-100709700 GGCTAACTGCAAGCCCTGAATGG - Intergenic
996106609 5:119511759-119511781 CAATAACAACAAGCCCTGGAAGG + Intronic
997345444 5:133188038-133188060 AAATAAGAACAACCCCAGAAAGG - Intergenic
1000578922 5:163011286-163011308 GAAAAACAAGCACCCCTGAAGGG + Intergenic
1006426105 6:33963834-33963856 GAATAACAGCAATGGCTGAAAGG - Intergenic
1008605179 6:53133145-53133167 AATTAACATTAACCCCTGAAGGG + Intronic
1008606225 6:53142306-53142328 GGGGAACATCAACCCCTGAAGGG + Intronic
1010480713 6:76349681-76349703 TAATAACAGCAACCCTTTAATGG - Intergenic
1012846926 6:104402024-104402046 AAATCACAGCAATCCCTGCAAGG + Intergenic
1013165969 6:107592397-107592419 ATATAACAAGAACCCCTGAAAGG + Intronic
1014243728 6:119045089-119045111 GAATATCAGCAATCCTTGAATGG - Intronic
1017786193 6:157759021-157759043 GAAAAACACCAACAGCTGAAGGG + Intronic
1017846521 6:158263208-158263230 GTTGAACAGTAACCCCTGAAAGG + Intronic
1018716306 6:166535378-166535400 GAGTAACAGCCACCCCCAAAAGG + Intronic
1019528191 7:1490409-1490431 GATAAACGGGAACCCCTGAAAGG + Intronic
1019528207 7:1490479-1490501 GATAAACGGGAACCCCTGAAAGG + Intronic
1020237232 7:6365673-6365695 GGGTAACAGCAACAACTGAATGG + Intergenic
1021467260 7:20958958-20958980 TAATTACAGCAGCCCATGAAAGG - Intergenic
1021773658 7:24030345-24030367 GAATAAGATCAATGCCTGAAGGG + Intergenic
1022001021 7:26226075-26226097 GAATCACTGCAACCCCCGTAGGG - Intergenic
1023533953 7:41188195-41188217 GAATGACAGCTACGCCTGATGGG - Intergenic
1023799843 7:43824379-43824401 ATATAACAGTAACCTCTGAAGGG + Intergenic
1023897415 7:44445437-44445459 GAATATCAGCATCCCTTTAATGG + Intronic
1024181740 7:46902316-46902338 ATCAAACAGCAACCCCTGAAAGG + Intergenic
1026311050 7:69184709-69184731 GTATAACAGAATCACCTGAAGGG - Intergenic
1028057442 7:86264045-86264067 AAATAACAGCAACTTTTGAAAGG + Intergenic
1029691802 7:102187420-102187442 GAATAACAGCAATTACTCAAGGG - Intronic
1031636229 7:124104383-124104405 GTATAACAGAAATCCATGAATGG - Intergenic
1032255727 7:130295654-130295676 GAAGCACAGCAACACCTGAAAGG - Intronic
1034315583 7:150128545-150128567 GAGAAACATCAACCCCAGAATGG + Intergenic
1034791306 7:153972260-153972282 GAGAAACATCAACCCCAGAATGG - Intronic
1036270887 8:7301745-7301767 GAAGAACAGCAGCCTGTGAATGG - Intergenic
1036350462 8:8008599-8008621 GAAGAACAGCAGCCTGTGAATGG + Intergenic
1041861165 8:62514052-62514074 GAATAACAGGAACTCTTGGAAGG - Intronic
1042078989 8:65028755-65028777 GAACAACAACAAACCCTGAGGGG + Intergenic
1043571335 8:81606322-81606344 GAGTAATAGGAACTCCTGAAAGG - Intergenic
1044138048 8:88611581-88611603 GTAAAACAGTAACCCCTGAAAGG - Intergenic
1044141329 8:88657183-88657205 GGATTACAGTAAGCCCTGAATGG - Intergenic
1044185283 8:89243400-89243422 GAGTAGGAGCAACCACTGAATGG - Intergenic
1044403775 8:91802766-91802788 GAACAGCAGCAACATCTGAAAGG - Intergenic
1046801312 8:118431183-118431205 GAATAACAGCAATGCCACAAGGG - Intronic
1048956270 8:139539146-139539168 GAATAAGAACAACCCCAGTAAGG + Intergenic
1049193849 8:141304778-141304800 GAACAACAGCAACCCATCCACGG + Intronic
1050007114 9:1143541-1143563 GAATAAAAGGAACCCCTGATTGG + Intergenic
1055372743 9:75617835-75617857 GACTTCCAGCAACCCCAGAACGG - Intergenic
1056127733 9:83553483-83553505 GAATCATAGGCACCCCTGAAAGG - Intergenic
1057335868 9:94154767-94154789 CAATAAAAGCAAGACCTGAAAGG + Intergenic
1060761728 9:126257718-126257740 GAATAAGAGCAACCCCAAGAGGG + Intergenic
1186155717 X:6724281-6724303 GAATAAATTCAAACCCTGAAAGG + Intergenic
1191634653 X:63362869-63362891 GTAAAACAGTAACCTCTGAAGGG - Intergenic
1192069397 X:67921061-67921083 ACATAACAGCAAGCCCAGAATGG + Intergenic
1194486519 X:94493065-94493087 GTAAAACAGTAACCTCTGAAAGG + Intergenic
1196317515 X:114246005-114246027 GAAAAACAGAAACCACAGAATGG + Intergenic