ID: 908783945

View in Genome Browser
Species Human (GRCh38)
Location 1:67716765-67716787
Sequence GCTTCCTGCTGATTTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908783945_908783949 16 Left 908783945 1:67716765-67716787 CCCATAGCAAATCAGCAGGAAGC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 908783949 1:67716804-67716826 TTGACAGAAGACCCAAGCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 95
908783945_908783948 -9 Left 908783945 1:67716765-67716787 CCCATAGCAAATCAGCAGGAAGC 0: 1
1: 0
2: 0
3: 7
4: 152
Right 908783948 1:67716779-67716801 GCAGGAAGCGTGAAGGCAAGTGG 0: 1
1: 0
2: 3
3: 18
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908783945 Original CRISPR GCTTCCTGCTGATTTGCTAT GGG (reversed) Intronic
902893576 1:19463079-19463101 CCTTCCTGCTGCCTTGCAATAGG - Intronic
903902887 1:26661206-26661228 ACTTGCTGATGATTTGATATAGG + Intergenic
907525657 1:55052581-55052603 GCCACCTGCTGATTTGTTATAGG + Intronic
907740633 1:57162362-57162384 GCTTCCTCCTTCTTTGCAATTGG - Intronic
908783945 1:67716765-67716787 GCTTCCTGCTGATTTGCTATGGG - Intronic
911117440 1:94260404-94260426 GCTTTCTTCAGAGTTGCTATGGG - Intronic
918689958 1:187467582-187467604 GCTTGCTGCTGATTTGTTGGAGG + Intergenic
920689573 1:208135570-208135592 GCTTGCTGTTGATTTGCTGAAGG - Intronic
920693008 1:208160991-208161013 GCTTTCTGGTGATTTGCTTCTGG + Intronic
921574332 1:216816509-216816531 GCTTAATGCTTATTTGCTTTTGG - Intronic
923518698 1:234719677-234719699 TCTGCCTGCTGTTTTGCTAATGG + Intergenic
924465795 1:244298284-244298306 GCTTGCTGCTGATTGGCTGGGGG + Intergenic
1065207172 10:23368201-23368223 ACTTCCTGCTGTTTTTCTCTAGG - Intergenic
1066712568 10:38251543-38251565 GTTTCCTGATGCTTTGCCATGGG - Intergenic
1069848312 10:71388442-71388464 CCTTCCTGCTTATGTGCCATTGG + Intergenic
1073195801 10:101690594-101690616 GGTTCCTTGTGATTTGCTAATGG - Intronic
1073392966 10:103193931-103193953 TCTTCCTGCTGAGTTGCTGGTGG - Intergenic
1074013609 10:109509406-109509428 TCTTCCTCCTGATTAGCTTTAGG + Intergenic
1081206142 11:40277743-40277765 GCTTACTGCTTATTTGCTTGCGG + Intronic
1085120345 11:73963592-73963614 GCTTCCTGTGGACTGGCTATTGG + Intronic
1085192577 11:74640926-74640948 GCTTCCAGATGATTTCCTTTTGG - Exonic
1086336527 11:85806654-85806676 GCCTCCTCCTGATTTTCTAAGGG - Intronic
1088190604 11:107224069-107224091 GCTTCCTTCTGGTTTTCTCTTGG - Intergenic
1088337011 11:108717100-108717122 GCTCATTGCTGATATGCTATGGG - Intronic
1088690314 11:112321041-112321063 GCTTCCAGTTGATCTGCCATGGG - Intergenic
1091160197 11:133413040-133413062 GCTTCCTGCAGAAGTTCTATGGG - Intronic
1095414940 12:41966242-41966264 GCTTTCTACTGATTTGATGTTGG - Intergenic
1101336186 12:103799133-103799155 GCTTCCTAATGACTTGCTTTGGG + Intronic
1104079572 12:125418032-125418054 GCCTCCTGCTGTTGTGCTACAGG + Intronic
1105052339 12:133065856-133065878 GCTTCCTCTTAATTTACTATTGG + Intergenic
1106441653 13:29779162-29779184 GCTCATTACTGATTTGCTATAGG - Intronic
1112968143 13:105224834-105224856 GCTTCCTCCTCATTTTCTCTTGG - Intergenic
1114090948 14:19289913-19289935 GCTTCCTGCTCATTAGACATTGG + Intergenic
1120754167 14:88226421-88226443 GCTTCCAGCTGATCTGCCTTTGG + Intronic
1120962849 14:90140992-90141014 CCTTCCTTCTCATTCGCTATGGG - Intronic
1125738382 15:41944125-41944147 GTTTCCTGATAATCTGCTATGGG + Intronic
1126420561 15:48467985-48468007 GCTTCCTGCTGCTGTTCTCTGGG - Exonic
1128377198 15:67085585-67085607 GATTCCTCATGATTTGCAATTGG + Intronic
1130202897 15:81849990-81850012 GCGTCCTGCAGGTTTGTTATGGG - Intergenic
1131007510 15:88990474-88990496 GCTTGCTGCTGATTGGCTCGGGG + Intergenic
1131909539 15:97182265-97182287 GCTTCCTTGAGTTTTGCTATTGG + Intergenic
1132207173 15:99994089-99994111 GCTTCCTTCTGCTTTGCTTTTGG - Intronic
1132458534 16:37691-37713 GCTTCCTGCTTAGAAGCTATTGG - Intergenic
1132948629 16:2547370-2547392 GCTTCCGGCTGCTTTTCCATGGG + Intronic
1132965958 16:2654757-2654779 GCTTCCGGCTGCTTTTCCATGGG - Intergenic
1137505630 16:49051679-49051701 GCCTCATGTTGATTTGCTGTTGG + Intergenic
1138705253 16:58908952-58908974 GCTTGCTGCTGATTGGCTGGGGG - Intergenic
1142550246 17:733606-733628 TTTTCCTGCAGATTTGCTAAAGG + Intronic
1144274272 17:13650146-13650168 GTTTCCTGCTGATTGCCTCTTGG + Intergenic
1144341083 17:14310744-14310766 CCTTCCTCCTGATGTGCTGTCGG + Intronic
1150218910 17:63484908-63484930 TCTTCCTGCTGCTCTGCTACGGG + Exonic
1153180964 18:2432529-2432551 ATTTCCTGCTGATATGCTAGAGG - Intergenic
1154565050 18:15883865-15883887 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154570717 18:15961248-15961270 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154578635 18:16069502-16069524 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154631672 18:16797037-16797059 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154635037 18:16842835-16842857 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154641682 18:16934090-16934112 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154642032 18:16938837-16938859 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154674356 18:17381591-17381613 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154694559 18:17658579-17658601 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154709610 18:17865061-17865083 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154729686 18:18139942-18139964 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154730735 18:18154537-18154559 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154732961 18:18185064-18185086 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154751027 18:18432507-18432529 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154762711 18:18592506-18592528 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154771501 18:18713428-18713450 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154801026 18:19119126-19119148 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154830557 18:19526493-19526515 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154849525 18:19787337-19787359 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1154899918 18:20482051-20482073 GCTTCCTGTCTATTTGTTATGGG - Intergenic
1158393322 18:57061108-57061130 GCTTCCTGCTCAGTTGCCAAGGG - Intergenic
1159475614 18:68916981-68917003 GCTTCCTACTGATTTCCTGCTGG - Intronic
1160129075 18:76208407-76208429 GCTTCCTCCTGAGTTTCTTTTGG - Intergenic
1165977395 19:39688593-39688615 TTTTCCTGCTGATTTGGTAATGG - Intergenic
927644080 2:24864455-24864477 GTTTTCTGCGGCTTTGCTATTGG - Intronic
928210413 2:29319698-29319720 GCTGGATGCTTATTTGCTATGGG + Intronic
928219268 2:29389856-29389878 GGTTCCTTCTGATTCGCTCTTGG - Intronic
928889654 2:36188980-36189002 GTGTCCTGCTGATCTGGTATGGG - Intergenic
930516571 2:52414873-52414895 ACTTCCTGCTGCTTTGCTTCAGG + Intergenic
930610735 2:53540037-53540059 GGTTTCTGCTGATTTGCAATTGG - Intronic
931464739 2:62476229-62476251 GCTCCCTGCAGGTTTGCTGTGGG + Intergenic
934126155 2:88892748-88892770 GCTTCATGCTGATGAGCTGTAGG + Intergenic
935500077 2:103828475-103828497 ACTTCCTCCTGATTAGCTGTTGG - Intergenic
935866161 2:107389902-107389924 GCTTCTTGATGGTATGCTATGGG - Intergenic
941294900 2:163725359-163725381 GTTTTCTGCTATTTTGCTATTGG - Intronic
941395250 2:164965916-164965938 GCTTGCTGCTGATTGGCTGGGGG + Intergenic
945770801 2:214039928-214039950 GCTTGCAGCTGATTGGCTAGGGG + Intronic
945971833 2:216238384-216238406 ACTTCCTGCCGATTTGCTTATGG + Intergenic
946798255 2:223379941-223379963 GCTCCCTGCTGACTTCATATAGG + Intergenic
948572255 2:238925069-238925091 GCTTCCTGCCGTTTTGGCATTGG + Intergenic
1170858646 20:20081793-20081815 GCTTCTTTCAGATTTTCTATGGG - Intronic
1173234807 20:41235034-41235056 GCTGCCTGCTGGTTTGGCATGGG - Intronic
1175196102 20:57244436-57244458 TCTTCCTCCTGATTTGCTCACGG - Intronic
1181530570 22:23514751-23514773 GCTTCCAGCTGCTCTGCCATTGG - Intergenic
950210607 3:11120362-11120384 ACTTCCTGCTGACTTCCTTTGGG - Intergenic
951953954 3:28233278-28233300 CCTTTCTGGTTATTTGCTATAGG - Intergenic
955526449 3:59825136-59825158 CCTTCCTGCTGATTTGCAGAGGG + Intronic
957729154 3:84109906-84109928 TCTGCTTGCTGATTTGCTGTGGG - Intergenic
959390944 3:105772652-105772674 TCTTCTTGCTGATTTGTTTTAGG - Intronic
959625421 3:108444317-108444339 CCTGTCTGCTGATTTGCTAATGG + Intronic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962349224 3:134644568-134644590 GCTTCCTGCTGGCTTGCAGTGGG + Intronic
962934911 3:140071486-140071508 GCTCTTTGCTGATTTTCTATTGG - Intronic
963928751 3:150979440-150979462 GCTGCCTGCCAATTTGCTAAAGG - Intergenic
964296720 3:155241041-155241063 GCTTTCTGCTGCTCTGCAATAGG - Intergenic
964638006 3:158878437-158878459 CATTCCTGATGATTTTCTATAGG + Intergenic
965857863 3:173110812-173110834 GCTTACTGCTAATTTACTAGAGG + Intronic
966296152 3:178426174-178426196 TCTTCCAGCTAATTTGTTATTGG + Intronic
967967477 3:194973503-194973525 GCCACCTTCTGATTTGCTAAGGG - Intergenic
970559178 4:17266266-17266288 GCTTGCTGCTCATTTGCAAGGGG - Intergenic
972961746 4:44461467-44461489 CCTTCCTGCTGGGTTGCTCTAGG - Intergenic
974177848 4:58346528-58346550 GATTTCTACTGATTTGTTATAGG + Intergenic
974708224 4:65551506-65551528 CCTTCTTTCTAATTTGCTATTGG + Intronic
976106352 4:81622794-81622816 CTTGCCTGCTGATTTTCTATGGG + Intronic
984869604 4:184314542-184314564 GCTAGCTGCCCATTTGCTATGGG - Intergenic
985022422 4:185705850-185705872 CCTTTCTTCTGAGTTGCTATTGG + Intronic
985632181 5:1019467-1019489 GCCACCTGCGGCTTTGCTATTGG - Intronic
987149622 5:15025652-15025674 CCTTCCTTCTGATTTGAGATAGG + Intergenic
989268684 5:39506470-39506492 GTGTCCTGATGATTTGTTATAGG - Intergenic
994792763 5:104251859-104251881 TCTTCCTGCTTATTTGATATAGG + Intergenic
995791210 5:115889831-115889853 GATTTCTGCTCATTTTCTATTGG - Intronic
997655282 5:135549731-135549753 GCTCCCAGCTGACTTGCTAGTGG - Intergenic
997710658 5:136001371-136001393 GCTTCCAGCTGATTGGCTACAGG + Intergenic
1000082636 5:157862386-157862408 GCTTCCTGCTGTCTTCCTCTGGG + Intergenic
1003077743 6:2998250-2998272 ACTTCCTGCTAATCTGGTATTGG - Intronic
1003085477 6:3056735-3056757 ACTTCCTGCTAATCTGGTATTGG + Intergenic
1005798633 6:29394964-29394986 TCTTTCTTCTGATTTCCTATTGG + Intronic
1007083396 6:39125202-39125224 GCTTCCTCATGATTTTGTATGGG + Intergenic
1012932767 6:105334019-105334041 GCTGGCTGCTAATTTGTTATAGG - Intronic
1015714188 6:136173859-136173881 GCTTCTTGCTCATTTGCCAAAGG + Exonic
1015865951 6:137726754-137726776 GCTCCCAGCTCATTTCCTATTGG + Intergenic
1019415559 7:925160-925182 GCTGCATGTTGATTTGTTATTGG - Intronic
1021834283 7:24652671-24652693 GCATCCTACTGAGATGCTATAGG + Intronic
1022621366 7:31987970-31987992 GCTTCCTGTTGAGTTTCTGTTGG + Intronic
1026828663 7:73598794-73598816 GCTTCCTGCTGCTTGGTTATAGG - Intronic
1031936994 7:127745681-127745703 GCTTCCTGCTCTTTTGCTAAGGG + Intronic
1032340546 7:131068626-131068648 GAGTCCTGCAGATTTCCTATTGG - Intergenic
1032494230 7:132348856-132348878 GCTTCCTGTTACTATGCTATGGG + Intronic
1033852421 7:145513813-145513835 TTTTGCTGCTGATTTGCTAATGG - Intergenic
1040327460 8:46359590-46359612 GCTTCCTTCTTATTTTTTATTGG + Intergenic
1041753652 8:61288751-61288773 GCTTCCTGGTGATTCTCCATTGG - Intronic
1043519785 8:81032525-81032547 CCTTCCTAGTGATTTGCTCTTGG + Intronic
1043775852 8:84267094-84267116 GATTCCTGCAGATCTGCTCTGGG - Intronic
1047669987 8:127135676-127135698 ACTTACTGCTAATTGGCTATGGG + Intergenic
1048594801 8:135855039-135855061 TCAGCCTGCTGATTTGTTATGGG + Intergenic
1048752626 8:137697360-137697382 GCTGCTGGCTGCTTTGCTATTGG - Intergenic
1050096547 9:2073299-2073321 GCGTCCAGCTGACTTGCTTTGGG - Exonic
1052157401 9:25209696-25209718 GCATCCTGTTAGTTTGCTATTGG - Intergenic
1053384018 9:37672775-37672797 GCTTCCTCCTTATTTTCTCTTGG - Intronic
1057576729 9:96248258-96248280 GTTTCTTGCTCAGTTGCTATTGG - Intronic
1057882338 9:98801982-98802004 GCTCCCTACTGAGTTGCTGTGGG - Intergenic
1187512291 X:19931528-19931550 GCTTCATGTTTATTTTCTATAGG - Intronic
1187866701 X:23729272-23729294 GCTTCCTCATGATTAGCTTTGGG - Intronic
1189732844 X:44039746-44039768 CCTTCCTGCTGTTTTGCCTTAGG + Intergenic
1194171366 X:90587625-90587647 GCTTCCAGCTTTTTTTCTATTGG - Intergenic
1198213329 X:134535031-134535053 GCTTCCTGCGGATTTGCAGGAGG + Intergenic
1199600261 X:149537501-149537523 GTTTCGTGCTGACCTGCTATTGG + Intergenic
1199650322 X:149942439-149942461 GTTTCGTGCTGACCTGCTATTGG - Intergenic