ID: 908784309

View in Genome Browser
Species Human (GRCh38)
Location 1:67720025-67720047
Sequence ACTTGTAGGAAGGAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908784309_908784317 30 Left 908784309 1:67720025-67720047 CCTTGCTGCTCCTTCCTACAAGT No data
Right 908784317 1:67720078-67720100 ACAGATGCTCACTTGCTTGGTGG No data
908784309_908784315 27 Left 908784309 1:67720025-67720047 CCTTGCTGCTCCTTCCTACAAGT No data
Right 908784315 1:67720075-67720097 CCCACAGATGCTCACTTGCTTGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908784309 Original CRISPR ACTTGTAGGAAGGAGCAGCA AGG (reversed) Intronic
No off target data available for this crispr