ID: 908786094

View in Genome Browser
Species Human (GRCh38)
Location 1:67736138-67736160
Sequence CACAGTTCCTGCAAGTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908786094_908786097 -9 Left 908786094 1:67736138-67736160 CCATTTCACTTGCAGGAACTGTG 0: 1
1: 0
2: 0
3: 10
4: 225
Right 908786097 1:67736152-67736174 GGAACTGTGGGAGAAGAACTAGG 0: 1
1: 0
2: 1
3: 30
4: 295
908786094_908786098 6 Left 908786094 1:67736138-67736160 CCATTTCACTTGCAGGAACTGTG 0: 1
1: 0
2: 0
3: 10
4: 225
Right 908786098 1:67736167-67736189 GAACTAGGAGTCTGTTCATTAGG No data
908786094_908786100 25 Left 908786094 1:67736138-67736160 CCATTTCACTTGCAGGAACTGTG 0: 1
1: 0
2: 0
3: 10
4: 225
Right 908786100 1:67736186-67736208 TAGGAACCCTGGCTCCACAAAGG 0: 1
1: 0
2: 2
3: 13
4: 93
908786094_908786099 14 Left 908786094 1:67736138-67736160 CCATTTCACTTGCAGGAACTGTG 0: 1
1: 0
2: 0
3: 10
4: 225
Right 908786099 1:67736175-67736197 AGTCTGTTCATTAGGAACCCTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908786094 Original CRISPR CACAGTTCCTGCAAGTGAAA TGG (reversed) Intronic