ID: 908786100

View in Genome Browser
Species Human (GRCh38)
Location 1:67736186-67736208
Sequence TAGGAACCCTGGCTCCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908786094_908786100 25 Left 908786094 1:67736138-67736160 CCATTTCACTTGCAGGAACTGTG 0: 1
1: 0
2: 0
3: 10
4: 225
Right 908786100 1:67736186-67736208 TAGGAACCCTGGCTCCACAAAGG 0: 1
1: 0
2: 2
3: 13
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908786100 Original CRISPR TAGGAACCCTGGCTCCACAA AGG Intronic