ID: 908792345

View in Genome Browser
Species Human (GRCh38)
Location 1:67795295-67795317
Sequence CTTTCCACCTAGAAGTCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908792339_908792345 16 Left 908792339 1:67795256-67795278 CCTTTTCTTGACATTTGATGTAC 0: 1
1: 0
2: 3
3: 67
4: 601
Right 908792345 1:67795295-67795317 CTTTCCACCTAGAAGTCTGACGG No data
908792342_908792345 -7 Left 908792342 1:67795279-67795301 CCAGACCAAAGGTCCACTTTCCA 0: 1
1: 0
2: 1
3: 10
4: 126
Right 908792345 1:67795295-67795317 CTTTCCACCTAGAAGTCTGACGG No data
908792341_908792345 -6 Left 908792341 1:67795278-67795300 CCCAGACCAAAGGTCCACTTTCC 0: 1
1: 0
2: 1
3: 6
4: 142
Right 908792345 1:67795295-67795317 CTTTCCACCTAGAAGTCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908792345 Original CRISPR CTTTCCACCTAGAAGTCTGA CGG Intronic
No off target data available for this crispr