ID: 908797159

View in Genome Browser
Species Human (GRCh38)
Location 1:67841974-67841996
Sequence CTGCAGGTAGAGTTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908797159_908797164 -7 Left 908797159 1:67841974-67841996 CCTGGCTCCAACTCTACCTGCAG No data
Right 908797164 1:67841990-67842012 CCTGCAGCAGGACTACCCCTGGG No data
908797159_908797162 -8 Left 908797159 1:67841974-67841996 CCTGGCTCCAACTCTACCTGCAG No data
Right 908797162 1:67841989-67842011 ACCTGCAGCAGGACTACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908797159 Original CRISPR CTGCAGGTAGAGTTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr