ID: 908799331

View in Genome Browser
Species Human (GRCh38)
Location 1:67863090-67863112
Sequence CAGAATGCTGCATGTAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908799331_908799333 22 Left 908799331 1:67863090-67863112 CCTATTTTACATGCAGCATTCTG No data
Right 908799333 1:67863135-67863157 ATGTCTCTCTATGAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908799331 Original CRISPR CAGAATGCTGCATGTAAAAT AGG (reversed) Intergenic
No off target data available for this crispr