ID: 908806352

View in Genome Browser
Species Human (GRCh38)
Location 1:67937075-67937097
Sequence AGAACAAGAAAGCAGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908806352_908806356 -1 Left 908806352 1:67937075-67937097 CCCTTCTTCTGCTTTCTTGTTCT No data
Right 908806356 1:67937097-67937119 TGTCTGGGCCCCCATATGATTGG No data
908806352_908806362 21 Left 908806352 1:67937075-67937097 CCCTTCTTCTGCTTTCTTGTTCT No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data
908806352_908806363 25 Left 908806352 1:67937075-67937097 CCCTTCTTCTGCTTTCTTGTTCT No data
Right 908806363 1:67937123-67937145 GTGCCTGTCCACATTGAGGTTGG No data
908806352_908806357 3 Left 908806352 1:67937075-67937097 CCCTTCTTCTGCTTTCTTGTTCT No data
Right 908806357 1:67937101-67937123 TGGGCCCCCATATGATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908806352 Original CRISPR AGAACAAGAAAGCAGAAGAA GGG (reversed) Intergenic