ID: 908806358

View in Genome Browser
Species Human (GRCh38)
Location 1:67937105-67937127
Sequence GGCACCATCCAATCATATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908806358_908806363 -5 Left 908806358 1:67937105-67937127 CCCCCATATGATTGGATGGTGCC No data
Right 908806363 1:67937123-67937145 GTGCCTGTCCACATTGAGGTTGG No data
908806358_908806362 -9 Left 908806358 1:67937105-67937127 CCCCCATATGATTGGATGGTGCC No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908806358 Original CRISPR GGCACCATCCAATCATATGG GGG (reversed) Intergenic