ID: 908806358 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:67937105-67937127 |
| Sequence | GGCACCATCCAATCATATGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908806358_908806363 | -5 | Left | 908806358 | 1:67937105-67937127 | CCCCCATATGATTGGATGGTGCC | No data | ||
| Right | 908806363 | 1:67937123-67937145 | GTGCCTGTCCACATTGAGGTTGG | No data | ||||
| 908806358_908806362 | -9 | Left | 908806358 | 1:67937105-67937127 | CCCCCATATGATTGGATGGTGCC | No data | ||
| Right | 908806362 | 1:67937119-67937141 | GATGGTGCCTGTCCACATTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908806358 | Original CRISPR | GGCACCATCCAATCATATGG GGG (reversed) | Intergenic | ||