ID: 908806359

View in Genome Browser
Species Human (GRCh38)
Location 1:67937106-67937128
Sequence AGGCACCATCCAATCATATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908806359_908806362 -10 Left 908806359 1:67937106-67937128 CCCCATATGATTGGATGGTGCCT No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data
908806359_908806363 -6 Left 908806359 1:67937106-67937128 CCCCATATGATTGGATGGTGCCT No data
Right 908806363 1:67937123-67937145 GTGCCTGTCCACATTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908806359 Original CRISPR AGGCACCATCCAATCATATG GGG (reversed) Intergenic