ID: 908806362

View in Genome Browser
Species Human (GRCh38)
Location 1:67937119-67937141
Sequence GATGGTGCCTGTCCACATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908806358_908806362 -9 Left 908806358 1:67937105-67937127 CCCCCATATGATTGGATGGTGCC No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data
908806353_908806362 20 Left 908806353 1:67937076-67937098 CCTTCTTCTGCTTTCTTGTTCTG No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data
908806352_908806362 21 Left 908806352 1:67937075-67937097 CCCTTCTTCTGCTTTCTTGTTCT No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data
908806359_908806362 -10 Left 908806359 1:67937106-67937128 CCCCATATGATTGGATGGTGCCT No data
Right 908806362 1:67937119-67937141 GATGGTGCCTGTCCACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908806362 Original CRISPR GATGGTGCCTGTCCACATTG AGG Intergenic