ID: 908806375

View in Genome Browser
Species Human (GRCh38)
Location 1:67937207-67937229
Sequence TAGAATGATTGGACAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908806375_908806386 26 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806386 1:67937256-67937278 CCTTTCAGCAGAAGAGGGAAGGG No data
908806375_908806378 -1 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806378 1:67937229-67937251 AGTCAAAAGCAAAACCACCTGGG No data
908806375_908806377 -2 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806377 1:67937228-67937250 TAGTCAAAAGCAAAACCACCTGG No data
908806375_908806381 20 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806381 1:67937250-67937272 GGCTTCCCTTTCAGCAGAAGAGG No data
908806375_908806382 21 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806382 1:67937251-67937273 GCTTCCCTTTCAGCAGAAGAGGG 0: 3
1: 1
2: 23
3: 38
4: 258
908806375_908806384 25 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908806375 Original CRISPR TAGAATGATTGGACAGCTCC AGG (reversed) Intergenic
No off target data available for this crispr