ID: 908806384

View in Genome Browser
Species Human (GRCh38)
Location 1:67937255-67937277
Sequence CCCTTTCAGCAGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908806375_908806384 25 Left 908806375 1:67937207-67937229 CCTGGAGCTGTCCAATCATTCTA No data
Right 908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG No data
908806376_908806384 14 Left 908806376 1:67937218-67937240 CCAATCATTCTAGTCAAAAGCAA No data
Right 908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908806384 Original CRISPR CCCTTTCAGCAGAAGAGGGA AGG Intergenic
No off target data available for this crispr