ID: 908811255

View in Genome Browser
Species Human (GRCh38)
Location 1:67984325-67984347
Sequence TACCCTTAAGGGCCCTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908811255_908811262 30 Left 908811255 1:67984325-67984347 CCACACTAGGGCCCTTAAGGGTA No data
Right 908811262 1:67984378-67984400 CAGACAATGGCCATCGTCTCAGG No data
908811255_908811261 17 Left 908811255 1:67984325-67984347 CCACACTAGGGCCCTTAAGGGTA No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908811255 Original CRISPR TACCCTTAAGGGCCCTAGTG TGG (reversed) Intergenic