ID: 908811261

View in Genome Browser
Species Human (GRCh38)
Location 1:67984365-67984387
Sequence GTAGTCAACAGCACAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908811252_908811261 21 Left 908811252 1:67984321-67984343 CCAGCCACACTAGGGCCCTTAAG No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811246_908811261 30 Left 908811246 1:67984312-67984334 CCCTTTGCCCCAGCCACACTAGG No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811255_908811261 17 Left 908811255 1:67984325-67984347 CCACACTAGGGCCCTTAAGGGTA No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811260_908811261 -10 Left 908811260 1:67984352-67984374 CCACAGGTCACTTGTAGTCAACA No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811256_908811261 6 Left 908811256 1:67984336-67984358 CCCTTAAGGGTACCATCCACAGG No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811259_908811261 -6 Left 908811259 1:67984348-67984370 CCATCCACAGGTCACTTGTAGTC No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811251_908811261 22 Left 908811251 1:67984320-67984342 CCCAGCCACACTAGGGCCCTTAA No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811258_908811261 5 Left 908811258 1:67984337-67984359 CCTTAAGGGTACCATCCACAGGT No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811250_908811261 23 Left 908811250 1:67984319-67984341 CCCCAGCCACACTAGGGCCCTTA No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data
908811248_908811261 29 Left 908811248 1:67984313-67984335 CCTTTGCCCCAGCCACACTAGGG No data
Right 908811261 1:67984365-67984387 GTAGTCAACAGCACAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908811261 Original CRISPR GTAGTCAACAGCACAGACAA TGG Intergenic