ID: 908811262

View in Genome Browser
Species Human (GRCh38)
Location 1:67984378-67984400
Sequence CAGACAATGGCCATCGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908811260_908811262 3 Left 908811260 1:67984352-67984374 CCACAGGTCACTTGTAGTCAACA No data
Right 908811262 1:67984378-67984400 CAGACAATGGCCATCGTCTCAGG No data
908811259_908811262 7 Left 908811259 1:67984348-67984370 CCATCCACAGGTCACTTGTAGTC No data
Right 908811262 1:67984378-67984400 CAGACAATGGCCATCGTCTCAGG No data
908811256_908811262 19 Left 908811256 1:67984336-67984358 CCCTTAAGGGTACCATCCACAGG No data
Right 908811262 1:67984378-67984400 CAGACAATGGCCATCGTCTCAGG No data
908811255_908811262 30 Left 908811255 1:67984325-67984347 CCACACTAGGGCCCTTAAGGGTA No data
Right 908811262 1:67984378-67984400 CAGACAATGGCCATCGTCTCAGG No data
908811258_908811262 18 Left 908811258 1:67984337-67984359 CCTTAAGGGTACCATCCACAGGT No data
Right 908811262 1:67984378-67984400 CAGACAATGGCCATCGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908811262 Original CRISPR CAGACAATGGCCATCGTCTC AGG Intergenic