ID: 908814949

View in Genome Browser
Species Human (GRCh38)
Location 1:68022210-68022232
Sequence GCATCCTTAGCAAAGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908814947_908814949 25 Left 908814947 1:68022162-68022184 CCACTTTAGAGGGCGGTTGTAGG No data
Right 908814949 1:68022210-68022232 GCATCCTTAGCAAAGTGTCCTGG No data
908814946_908814949 26 Left 908814946 1:68022161-68022183 CCCACTTTAGAGGGCGGTTGTAG No data
Right 908814949 1:68022210-68022232 GCATCCTTAGCAAAGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908814949 Original CRISPR GCATCCTTAGCAAAGTGTCC TGG Intergenic