ID: 908818540

View in Genome Browser
Species Human (GRCh38)
Location 1:68058431-68058453
Sequence CAGGCCCACCTGCAGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908818536_908818540 6 Left 908818536 1:68058402-68058424 CCACCTCTTGTGGAGGGCCTGAC 0: 177
1: 128
2: 50
3: 45
4: 117
Right 908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG No data
908818535_908818540 9 Left 908818535 1:68058399-68058421 CCTCCACCTCTTGTGGAGGGCCT 0: 178
1: 123
2: 43
3: 46
4: 138
Right 908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG No data
908818537_908818540 3 Left 908818537 1:68058405-68058427 CCTCTTGTGGAGGGCCTGACATT 0: 37
1: 158
2: 93
3: 54
4: 150
Right 908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908818540 Original CRISPR CAGGCCCACCTGCAGTTTTC TGG Intergenic
No off target data available for this crispr