ID: 908818668

View in Genome Browser
Species Human (GRCh38)
Location 1:68059385-68059407
Sequence CACAAATAGAATTCAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908818667_908818668 -1 Left 908818667 1:68059363-68059385 CCAGAAGAGATGGTTGATATGAC No data
Right 908818668 1:68059385-68059407 CACAAATAGAATTCAGAACATGG No data
908818663_908818668 29 Left 908818663 1:68059333-68059355 CCTCATCACCTCTCAAGCAAGGG No data
Right 908818668 1:68059385-68059407 CACAAATAGAATTCAGAACATGG No data
908818665_908818668 21 Left 908818665 1:68059341-68059363 CCTCTCAAGCAAGGGTTCAGAAC No data
Right 908818668 1:68059385-68059407 CACAAATAGAATTCAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908818668 Original CRISPR CACAAATAGAATTCAGAACA TGG Intergenic
No off target data available for this crispr