ID: 908820294

View in Genome Browser
Species Human (GRCh38)
Location 1:68078784-68078806
Sequence AGAGCCACCTAGATGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908820294_908820303 17 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820303 1:68078824-68078846 CATGGTTGGGGGATGCAGTGGGG No data
908820294_908820304 18 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820304 1:68078825-68078847 ATGGTTGGGGGATGCAGTGGGGG No data
908820294_908820301 15 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820301 1:68078822-68078844 AGCATGGTTGGGGGATGCAGTGG No data
908820294_908820307 24 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820307 1:68078831-68078853 GGGGGATGCAGTGGGGGAAGGGG No data
908820294_908820300 6 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820300 1:68078813-68078835 CAGTCTAGAAGCATGGTTGGGGG No data
908820294_908820308 25 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820308 1:68078832-68078854 GGGGATGCAGTGGGGGAAGGGGG No data
908820294_908820299 5 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820299 1:68078812-68078834 TCAGTCTAGAAGCATGGTTGGGG No data
908820294_908820297 3 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820297 1:68078810-68078832 CCTCAGTCTAGAAGCATGGTTGG 0: 6
1: 3
2: 11
3: 13
4: 151
908820294_908820298 4 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820298 1:68078811-68078833 CTCAGTCTAGAAGCATGGTTGGG No data
908820294_908820302 16 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820302 1:68078823-68078845 GCATGGTTGGGGGATGCAGTGGG No data
908820294_908820306 23 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820306 1:68078830-68078852 TGGGGGATGCAGTGGGGGAAGGG No data
908820294_908820305 22 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820305 1:68078829-68078851 TTGGGGGATGCAGTGGGGGAAGG No data
908820294_908820295 -1 Left 908820294 1:68078784-68078806 CCACAAAACATCTAGGTGGCTCT No data
Right 908820295 1:68078806-68078828 TCTGCCTCAGTCTAGAAGCATGG 0: 8
1: 5
2: 11
3: 25
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908820294 Original CRISPR AGAGCCACCTAGATGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr