ID: 908822461

View in Genome Browser
Species Human (GRCh38)
Location 1:68102518-68102540
Sequence GATACAACCCCAGCTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908822461_908822467 15 Left 908822461 1:68102518-68102540 CCAGACCCAGCTGGGGTTGTATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 908822467 1:68102556-68102578 TGATTGCAGGTCCACTTTAAGGG 0: 1
1: 0
2: 1
3: 3
4: 67
908822461_908822465 2 Left 908822461 1:68102518-68102540 CCAGACCCAGCTGGGGTTGTATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 908822465 1:68102543-68102565 TTTGAAGGTCATCTGATTGCAGG No data
908822461_908822466 14 Left 908822461 1:68102518-68102540 CCAGACCCAGCTGGGGTTGTATC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 908822466 1:68102555-68102577 CTGATTGCAGGTCCACTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908822461 Original CRISPR GATACAACCCCAGCTGGGTC TGG (reversed) Intronic
900168380 1:1254201-1254223 GAAACAGCCCCTGCTGGCTCTGG + Intronic
902870236 1:19309777-19309799 AAAAGAACCCCAGCTGGGCCAGG + Intronic
903495365 1:23762861-23762883 GATACAAAACTAGCTGGGTGTGG + Intergenic
903826314 1:26148088-26148110 GAGACTACCACAGCTGGGTGCGG + Intergenic
904505360 1:30948467-30948489 GAAACAACGACAGCTGGGTATGG + Intronic
905153378 1:35951239-35951261 AATGCAACCACAGCTGGGTGTGG - Intronic
908822461 1:68102518-68102540 GATACAACCCCAGCTGGGTCTGG - Intronic
909157494 1:72096970-72096992 GATATAACTACAGCTGGGTGCGG - Intronic
910012855 1:82486797-82486819 GAAACACCCTCAGCTGGGACAGG - Intergenic
910420244 1:87053144-87053166 GATTCAACTCCAGCTGGGTTTGG - Intronic
914223761 1:145703538-145703560 GATTCAAACCCAGTTGAGTCTGG + Intronic
920301901 1:204994098-204994120 GATACAACCTCAGCTGGCTAAGG - Intronic
921088008 1:211814635-211814657 GGTACAACCCTAAGTGGGTCAGG + Intronic
922511628 1:226172973-226172995 CAAACAAACCCAGCTGGGCCTGG + Intronic
922566613 1:226605529-226605551 GATACAATCCCACCTGTGTCTGG + Exonic
924453951 1:244203064-244203086 AATTCAAGCCCAGCTGTGTCTGG - Intergenic
1062856358 10:781352-781374 GATACACCCACACCTGGGCCTGG + Intergenic
1063683818 10:8216672-8216694 GAAAAAACCCAAGCTGGGCCGGG - Intergenic
1073275488 10:102306712-102306734 GAGACAGCCCCGGCTGGGTGCGG - Intronic
1074063183 10:109987146-109987168 GATTCAATCCCAGCTTTGTCTGG - Intergenic
1074685687 10:115960596-115960618 AATACAATCCCAGTTGGGTTAGG + Intergenic
1076060184 10:127407917-127407939 GAGACAGCCCCAGATGGGACAGG + Intronic
1076365819 10:129920520-129920542 GCTAGCGCCCCAGCTGGGTCAGG - Intronic
1080818502 11:35782202-35782224 GATCCTACCCCAGCTGGATTAGG - Intronic
1085360748 11:75883271-75883293 GATATAAGCTCAGCTGGGTATGG - Intronic
1085455613 11:76663788-76663810 GATGGAGCCCCAGCTGTGTCAGG + Intronic
1086382732 11:86274649-86274671 GATACCACCCTAGCTGGGAAGGG + Intronic
1092903544 12:13082253-13082275 GATACAAGCCCAGCCGGGCATGG - Exonic
1096185476 12:49577762-49577784 GAGATAAGCCCAGCTGGGGCTGG - Intronic
1097600384 12:61684729-61684751 GATAAAACCCCAGTTCAGTCTGG - Intergenic
1105642392 13:22279285-22279307 GATAGAACCCCAGTGGGGTTGGG + Intergenic
1106472582 13:30070689-30070711 GATATAACCCCAGCTCTCTCAGG - Intergenic
1107880301 13:44826719-44826741 GATTCAATCCCAGCAGGGTAGGG + Intergenic
1109271476 13:60260592-60260614 GATACCACTCCAGCAGGGACAGG + Intergenic
1114569697 14:23657961-23657983 AAGACAACCCCAGCAGGGCCTGG - Intergenic
1117438602 14:55740564-55740586 AATCCACCCCCAGCTGGGTTAGG - Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1123007420 14:105330538-105330560 GCCACACACCCAGCTGGGTCAGG - Intronic
1123069063 14:105632298-105632320 GATGGATCCCCAGCTGGGACTGG - Intergenic
1124108789 15:26767232-26767254 TTTCCAACCCCAACTGGGTCAGG + Intronic
1125469882 15:39992515-39992537 GATAAGACCCCAGATGGATCAGG - Intronic
1127191685 15:56537961-56537983 GATCAAACCACAGCTGGGTTTGG - Intergenic
1127390894 15:58504228-58504250 GTTACAACCCCAGATGGGGTTGG - Intronic
1127967018 15:63930102-63930124 TATTTAACCCCAGCTGGGGCAGG + Intronic
1129994840 15:79995766-79995788 GATGCATCCCCAGCCGGGTGTGG + Intergenic
1132754736 16:1477523-1477545 GAGACAACCTCACGTGGGTCTGG + Intergenic
1134072170 16:11267153-11267175 GGTACAACCCCGGCATGGTCTGG + Intronic
1143831822 17:9658462-9658484 GATTCAAGCCCAGGGGGGTCTGG + Intronic
1151388167 17:73768029-73768051 GCTAGAACCCCAGCTGCATCTGG - Intergenic
1151673168 17:75583919-75583941 GATACAAACCAGGCTGGGTGCGG + Intergenic
1151828493 17:76536764-76536786 GATACAATCCCTGCTGAGTTTGG - Intronic
1152262866 17:79276527-79276549 AATACAAAATCAGCTGGGTCTGG + Intronic
1152505587 17:80747672-80747694 GATGCAAACCCAGCAGCGTCTGG + Intronic
1152795785 17:82305456-82305478 TATACAACCCCAGCCGGGTGAGG - Intergenic
1157219858 18:45820637-45820659 GATGAACCCCCAGCTGGCTCAGG - Intergenic
1160097581 18:75889513-75889535 GAAACAAACCCTGCTGGCTCAGG - Intergenic
1162204932 19:9048829-9048851 GAAACAAACACAACTGGGTCAGG + Intergenic
1162293976 19:9800242-9800264 GATAAAACCCCATCTTGGCCGGG - Intergenic
1163299392 19:16434198-16434220 GGTCCAGCCCCAGCTGGCTCAGG - Intronic
1163406189 19:17124479-17124501 GATACAAACACAGCTGGGCGTGG + Intronic
1165104603 19:33461618-33461640 GATTCAACTCAAGCTGGGACAGG + Intronic
1165755246 19:38289071-38289093 GACACAGGCCTAGCTGGGTCTGG - Intronic
1166729139 19:45048591-45048613 GATTCAAACCCAGATGGGCCTGG - Intronic
926800708 2:16657784-16657806 CATACATGCCCAGCAGGGTCTGG + Intronic
927671162 2:25069985-25070007 GTTACAACCCTGGCTGGGTGTGG - Intronic
928242948 2:29602314-29602336 CATAGAATCCCAGCAGGGTCAGG + Intronic
930731218 2:54729855-54729877 GAAACATCCCCAGCTCGGCCAGG + Intronic
933165356 2:79069413-79069435 TAAACAACCCCAGCTGAGTGTGG - Intergenic
933452984 2:82480432-82480454 TAGCCAAACCCAGCTGGGTCAGG - Intergenic
935033283 2:99343244-99343266 AATACAACCCAGGCTGGGTGCGG - Intronic
935262945 2:101370765-101370787 GAATCAAGCCCAGCAGGGTCAGG + Intronic
937254652 2:120546634-120546656 GAAACAAACCCAGCTGTGTTTGG + Intergenic
938825653 2:135003028-135003050 GACACAAATCCAGCTGGATCGGG - Intronic
940957050 2:159739161-159739183 TCTACAGCCACAGCTGGGTCAGG + Intronic
941319352 2:164034963-164034985 AATACAAAACCAGCTGGGTGTGG - Intergenic
943298249 2:186164614-186164636 GATACTACCCCTGCTGGGAAGGG - Intergenic
943582579 2:189702126-189702148 GATAAAACCCCAGCAGGTTAGGG + Intronic
947885312 2:233564723-233564745 GTTACATTCCCAGCAGGGTCTGG + Intronic
948217857 2:236245074-236245096 GAGTCAACCTCAGCTGGGTGTGG + Intronic
1170143465 20:13148246-13148268 AAAACAAAACCAGCTGGGTCAGG - Intronic
1171034605 20:21705420-21705442 GTCCCAACCCCAGCTGGGCCTGG - Intergenic
1171403448 20:24893708-24893730 GATTCAAGCTCAGCGGGGTCAGG - Intergenic
1171797356 20:29577007-29577029 GATAGAACCCAAGTTGGGACAGG - Intergenic
1173839030 20:46144964-46144986 CATACAACGCTAGCTGGGTGTGG + Intergenic
1175980696 20:62737194-62737216 TTTACAACTCCAGGTGGGTCTGG - Intronic
1178433624 21:32537721-32537743 GATCCTACTCCAGCTGGCTCTGG - Intergenic
1182259282 22:29061420-29061442 AATACAACATCAGCTGGGTGCGG - Intronic
1183025515 22:35063213-35063235 GATTCAAACCCAGGTGAGTCTGG + Intergenic
950454928 3:13087032-13087054 CATTCACCCCCAGCTGGTTCAGG + Intergenic
952230050 3:31420192-31420214 GTAACAACTCCAGCAGGGTCTGG - Intergenic
953941466 3:47102498-47102520 GTTACAATCCCAGCTGGGTGCGG + Intronic
954274025 3:49531025-49531047 GATACCACCTCACCAGGGTCTGG - Exonic
955963920 3:64368703-64368725 AAGACAGCCCCAGCTGGGTGGGG + Intronic
957403358 3:79745533-79745555 GCTTCAACCCTAGCTGTGTCTGG - Intronic
961498710 3:127315277-127315299 GATAGAATCCCAGATGGGTTTGG - Intergenic
961528675 3:127526167-127526189 GAAAGAACCCCAGATGGGGCTGG + Intergenic
961762840 3:129184108-129184130 GGTTCATTCCCAGCTGGGTCCGG + Intergenic
962948359 3:140194885-140194907 GATACAACCCCAGTGGGGAGAGG + Intronic
963840196 3:150096908-150096930 GGGACATCCCCAGCTGGGCCAGG + Intergenic
963948474 3:151171740-151171762 GATACAAACCTGGCTGGGCCTGG - Intronic
978111009 4:104964021-104964043 GGGACAAGCCCTGCTGGGTCTGG - Intergenic
981659500 4:147149057-147149079 GAGATAACCCAAGCAGGGTCAGG - Intergenic
986217266 5:5731294-5731316 AAGACAACCCCAGCTGTGACGGG - Intergenic
996807687 5:127475803-127475825 GATAAAACCCCAGCAGGTTAGGG + Intergenic
996846858 5:127909190-127909212 GATACACACCCAGGTGGGTCTGG + Intergenic
998225638 5:140324368-140324390 GAAACTAACCCAGCTGGGACAGG + Intergenic
998265971 5:140668181-140668203 AATGCAACCCAGGCTGGGTCTGG + Intronic
999146879 5:149402142-149402164 GATACAAGACCACATGGGTCTGG - Intronic
1002060907 5:176625554-176625576 GATTCAAACCCAGCTGAGGCTGG + Intronic
1003462813 6:6347364-6347386 GAAACATGCCGAGCTGGGTCAGG - Intergenic
1003756014 6:9121607-9121629 GAAACAAACCCAACTAGGTCAGG - Intergenic
1006419184 6:33922940-33922962 GACACAACCCCCACTGGGCCCGG + Intergenic
1015273255 6:131358635-131358657 GATACCACCCCAGCAGAGGCGGG - Intergenic
1018382830 6:163275016-163275038 AAAACAAACCTAGCTGGGTCTGG - Intronic
1019307585 7:343228-343250 GATACAACCCCAGATGCTGCTGG - Intergenic
1023907054 7:44530645-44530667 CATAAAACCTCAGCAGGGTCTGG + Intronic
1025753679 7:64314208-64314230 GATACCACCGCAGCCGGTTCCGG - Intronic
1026569750 7:71519101-71519123 GGTACAAGTCCAGCTGGCTCAGG + Intronic
1031088378 7:117324522-117324544 GATACATCCCCGTTTGGGTCCGG + Intergenic
1031752436 7:125593532-125593554 GATAGGACCCCAGGTGGGTAGGG + Intergenic
1033155073 7:138949840-138949862 GAGCCAACCCCAGCAGGGGCCGG + Intronic
1034397868 7:150840932-150840954 GTTACAAAGCCAGCTGGTTCTGG + Intronic
1035473725 7:159128161-159128183 GACACCACCCCAGCTTAGTCAGG + Intronic
1036114430 8:5943449-5943471 GATACAACTCCAGTTGGGTTAGG + Intergenic
1037535061 8:19816705-19816727 TATAAAACCCTTGCTGGGTCAGG + Intergenic
1039489448 8:37936515-37936537 GATCCAAGCCAAGCTGGGTTGGG + Intronic
1040449513 8:47530286-47530308 GGTGAAACCCCAGCTGGGTGTGG + Intronic
1040570607 8:48605891-48605913 GATACCACCCCAGCTGGTAGAGG - Intergenic
1049024832 8:139981153-139981175 GATACAAACCCAGATGGCTCTGG - Intronic
1051892523 9:21957832-21957854 GCTTCAAGCCCAGCTAGGTCTGG + Intronic
1052377150 9:27730298-27730320 AATACAGCCACAGCTGGGGCTGG + Intergenic
1053896948 9:42752008-42752030 AATACAATCCCGGCTGGGTGCGG - Intergenic
1055151445 9:73005314-73005336 GATAAAATTCCAGCTGGGTGCGG + Intronic
1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG + Intronic
1060807413 9:126586395-126586417 GATGCAAACCCAGGTTGGTCTGG - Intergenic
1190443219 X:50496387-50496409 GATTCAAACCCAGGTGTGTCTGG - Intergenic
1193049109 X:77082488-77082510 GGACCAAACCCAGCTGGGTCTGG - Intergenic
1201731491 Y:17209144-17209166 CATAAAACCCCTGGTGGGTCAGG - Intergenic