ID: 908822472

View in Genome Browser
Species Human (GRCh38)
Location 1:68102604-68102626
Sequence CAGCAAATACAGATGAATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908822472_908822473 0 Left 908822472 1:68102604-68102626 CCTATATTCATCTGTATTTGCTG 0: 1
1: 0
2: 0
3: 24
4: 271
Right 908822473 1:68102627-68102649 AAATATGACTATTTCTCAATTGG 0: 1
1: 0
2: 3
3: 27
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908822472 Original CRISPR CAGCAAATACAGATGAATAT AGG (reversed) Intronic
900766626 1:4510166-4510188 CTGAAAATACAGAGGAATTTAGG + Intergenic
902049083 1:13547796-13547818 CAGCATCTACAGAAGTATATGGG - Intergenic
906758881 1:48352473-48352495 ATGCAAATACAGCAGAATATAGG + Intronic
906912449 1:49969003-49969025 AAGCAAATACAGATGCATTTTGG - Intronic
907445661 1:54506269-54506291 CAGAAAATACAGAGGAAACTGGG - Intergenic
908020840 1:59896912-59896934 CAGCAAATAGAATTGACTATAGG - Intronic
908147761 1:61265551-61265573 TAACAAATACACATGAATATAGG - Intronic
908612656 1:65879980-65880002 CAGCAAATACAGATGTTTTGGGG - Intronic
908822472 1:68102604-68102626 CAGCAAATACAGATGAATATAGG - Intronic
910481853 1:87667554-87667576 CATCAAATATAGCTGAATATTGG + Intergenic
910790760 1:91047527-91047549 CAGGAAATACAGATCATTATAGG + Intergenic
911618796 1:100043350-100043372 CATCAAGAAGAGATGAATATGGG + Intronic
912056307 1:105603086-105603108 CACCAACTATAGGTGAATATTGG + Intergenic
912083054 1:105962110-105962132 CAGCTAATACATAAGAATAATGG + Intergenic
912922158 1:113879605-113879627 CAGCAAACACAGCTGTAGATAGG - Intronic
913354935 1:117909749-117909771 CAGCAGATAAAGATCAATAATGG - Intronic
913392227 1:118326873-118326895 CAGAAAATAGAAATGAACATTGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
917109391 1:171529684-171529706 CAACTACTACAGAAGAATATGGG - Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
919127408 1:193412158-193412180 TAGCAAATATAGATGAAGATGGG - Intergenic
919950765 1:202361217-202361239 CAACAAAAACAGACTAATATAGG - Intronic
920346381 1:205308358-205308380 CAGCACATACCGATAAAGATAGG - Intronic
920570912 1:207016600-207016622 CAGCACACACAGATGCAGATAGG + Intronic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
923931414 1:238702925-238702947 CAAAATCTACAGATGAATATTGG + Intergenic
1065837070 10:29668246-29668268 AAGAAAAAACAGAGGAATATGGG + Intronic
1066473384 10:35721207-35721229 AAGCAAAATCAGATTAATATTGG - Intergenic
1066958062 10:42191685-42191707 CAGCAAATACCCATGTATGTGGG + Intergenic
1067407037 10:46032602-46032624 AAGCAAACACAGAGGAATGTGGG + Intergenic
1068979036 10:63041941-63041963 CAGGAAAAACAAATGAATATTGG + Intergenic
1069612295 10:69782431-69782453 CATCAATTACACATGAACATTGG - Intergenic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1075356910 10:121787283-121787305 CAGAAAATAGAGCTTAATATGGG - Intronic
1077406606 11:2385227-2385249 CAGTAAATACAGATGTTTAAGGG + Intronic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1080543162 11:33288852-33288874 CATCAAATACAGACAAATACAGG + Intronic
1080642276 11:34164942-34164964 CACCAAATGCAGATGAGTGTGGG - Intronic
1081565114 11:44255937-44255959 TAGCAAATAGAGATGCATGTTGG + Intergenic
1082016990 11:47497018-47497040 CAGCCAATACTGAGGAATTTTGG + Intronic
1083096033 11:60252481-60252503 CAGCAAAAACAAATGCAGATGGG + Intergenic
1083576090 11:63792778-63792800 CAGCAACTACACATGGATAAGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086262565 11:84958202-84958224 CAGGAAATATATATGAATAAAGG - Intronic
1086682369 11:89688289-89688311 CAACAAATACAGATGATAAATGG + Intergenic
1087062906 11:93999620-93999642 GACTAAATACAGGTGAATATAGG + Intergenic
1089168434 11:116495672-116495694 CAGCAAATACAGAGAAAGGTAGG - Intergenic
1091112411 11:132982157-132982179 CAGCAAAGGCAGAAGAAAATGGG - Intronic
1091921320 12:4307305-4307327 CAGCAAATGCAAATGAGTCTGGG + Intergenic
1092533489 12:9364707-9364729 AAGCAAATGCAAATGAATCTGGG - Intergenic
1093361266 12:18231884-18231906 CAGCAAAAAAAGAAAAATATAGG - Intronic
1094566911 12:31607126-31607148 CAGCAAAGGCAGAAGAAAATTGG - Intergenic
1095392478 12:41725560-41725582 CAACAAAAACAGATAAATATTGG - Intergenic
1097048146 12:56203378-56203400 CAGCAAATACTTATGAAGACTGG + Exonic
1097341228 12:58440406-58440428 AAGCAAATACATATGATTCTAGG + Intergenic
1097442513 12:59628223-59628245 CAACAAATAGAGGTCAATATGGG - Intronic
1097988630 12:65810907-65810929 CCTCAGTTACAGATGAATATTGG - Intergenic
1098015966 12:66104841-66104863 CATTAAATACAGGTGGATATTGG + Intergenic
1099328262 12:81247238-81247260 CCGGAAATGCAGGTGAATATTGG - Intronic
1100357476 12:93844910-93844932 CTCCTAATACAGATCAATATGGG + Intronic
1102031446 12:109742192-109742214 CAGCAAACACATATGTACATAGG + Intronic
1102033433 12:109757901-109757923 CAGCAAACACAGACAAATCTGGG + Intronic
1102454290 12:113062092-113062114 CAGCACATACACATGAGTTTTGG - Intronic
1102684815 12:114716548-114716570 CAGCACACAGAGATGAATAGGGG + Intergenic
1104024854 12:125018288-125018310 CAGATAAAACAGATGAATACGGG - Intronic
1104170422 12:126275187-126275209 CAGCAAATTGAGATTAATGTAGG + Intergenic
1104195053 12:126528671-126528693 CAGCACAAACAGAAGAATACAGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106443112 13:29797930-29797952 AAGCAAAGACAGAGGAATAGAGG - Intronic
1107680560 13:42844422-42844444 CAGCAAATGCAGATTATGATAGG - Intergenic
1108318916 13:49267813-49267835 AAGCAAATACTGATGACTATAGG + Exonic
1108621460 13:52188586-52188608 CAGAACAAACAGATTAATATAGG - Intergenic
1108808816 13:54194605-54194627 AAGCAGATACAAATTAATATTGG + Intergenic
1108877781 13:55069346-55069368 TAGCAAATACAAATCAATAGTGG - Intergenic
1109352297 13:61199644-61199666 TAGCAAATACACGTAAATATTGG - Intergenic
1109916625 13:68995690-68995712 CAGGAAATGCAGATGGTTATTGG + Intergenic
1109997718 13:70151430-70151452 CAGCAAAAATAGATGAACCTGGG - Intergenic
1110175548 13:72551289-72551311 CAGCAAATAAATATTTATATTGG - Intergenic
1110380155 13:74841140-74841162 CAGGAGATACAGATGATTGTTGG - Intergenic
1111156251 13:84330481-84330503 GAGCAGATACATATGGATATAGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1112083166 13:95998688-95998710 CATAAAATACAGATAGATATTGG + Intronic
1112921036 13:104613055-104613077 CAGCAAGTACAGGTGAAACTGGG + Intergenic
1114641458 14:24224831-24224853 CAGGAAATACAGAGGAAAAGAGG + Intronic
1116010823 14:39349907-39349929 CTTCAAATACAGATGATTAAAGG - Intronic
1116692472 14:48127538-48127560 AAGGAAATATATATGAATATAGG + Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117215360 14:53545980-53546002 GGTCAAATACAGTTGAATATTGG - Intergenic
1118813201 14:69290445-69290467 CACCAAACACAGATGATTCTGGG - Intronic
1119280774 14:73405662-73405684 CAGCAACAACAGAAGAATCTGGG + Intronic
1120385972 14:83846356-83846378 CAGGAAAGACAGGTGAATAAAGG + Intergenic
1120497294 14:85253052-85253074 CAGGCAATACAGGGGAATATTGG + Intergenic
1120794946 14:88622459-88622481 CAGCAAAGACAGAGTAATGTTGG + Exonic
1121037045 14:90714888-90714910 GAGAAAATAGAGATGAAAATTGG - Intronic
1123459184 15:20453062-20453084 CAGGAAATAAATATCAATATAGG + Intergenic
1123658876 15:22547356-22547378 CAGGAAATAAATATCAATATAGG - Intergenic
1124265424 15:28228912-28228934 CAGGAAATAAATATTAATATAGG + Intronic
1124312742 15:28641848-28641870 CAGGAAATAAATATCAATATAGG - Intergenic
1124681764 15:31738177-31738199 CAGCAAAGACAGAAGAACTTGGG + Intronic
1125071980 15:35565808-35565830 CAGGAAATACAGAGAATTATTGG - Intergenic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126300370 15:47188354-47188376 CAGGAAATATAAATGAATATTGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1129629603 15:77244468-77244490 AAGCCAATAGGGATGAATATAGG + Intronic
1130745038 15:86643407-86643429 CAGCAAATATAGGGGCATATAGG - Intronic
1130786875 15:87107964-87107986 CAACAAATAAAGAAAAATATAGG + Intergenic
1131607586 15:93924631-93924653 CAGCAAAATCAGTAGAATATAGG + Intergenic
1131897613 15:97050856-97050878 TAGCAAATACTTATTAATATTGG + Intergenic
1132221224 15:100107001-100107023 TATCAAATACAGATAAATGTGGG - Intronic
1133524795 16:6594211-6594233 CAGCAAATAATGCTGAATGTTGG + Intronic
1133611501 16:7437864-7437886 CAGAAAAAAAAAATGAATATAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135271047 16:21070154-21070176 CACCAAATACACATGCATTTGGG - Intronic
1136025618 16:27466646-27466668 CAGCCAATATAGATGAAAACTGG + Intronic
1136703600 16:32166247-32166269 CAGGAAATAAATATTAATATAGG + Intergenic
1138325812 16:56166278-56166300 GAGCAAATAGAAATGATTATGGG - Intergenic
1141135439 16:81461885-81461907 CAGCACATACTGCTGAATGTTGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141356181 16:83349037-83349059 CTGCACATACAGATAAATATGGG - Intronic
1203066457 16_KI270728v1_random:1023477-1023499 CAGGAAATAAATATTAATATAGG - Intergenic
1144129910 17:12236483-12236505 CAGAAAATACAGAAAAAAATCGG + Intergenic
1147452592 17:40515045-40515067 CATCAAATACAGATGAGTTAAGG + Intergenic
1149971826 17:61226644-61226666 CAGAAAATACACATGAGTACTGG - Intronic
1150359527 17:64519091-64519113 CAGCAAATACTGGTGACTCTAGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156641239 18:39102006-39102028 TAGAAAATAAAAATGAATATTGG + Intergenic
1156758586 18:40558828-40558850 CAGAAAATGCAGATGAGTGTAGG + Intergenic
1159089095 18:63826566-63826588 CAAAAAATGTAGATGAATATGGG + Intergenic
1159452885 18:68624945-68624967 TAGGAAATACAGAAGAATATAGG - Intergenic
1163740019 19:19005929-19005951 CAGCAGAAACAAATGAATCTGGG + Intronic
1166097547 19:40550449-40550471 CAGCAGATACAGATGTATCCAGG + Intronic
925075963 2:1015850-1015872 CAGCAGATACAGATGATGCTGGG - Intronic
926627857 2:15108373-15108395 CAGCCAATAAGGATGGATATGGG + Intergenic
930148887 2:48037668-48037690 CAGCTAATACAGATGATGAAAGG - Intergenic
930654776 2:53997070-53997092 CTGTAAATACAAACGAATATTGG - Intronic
931413218 2:62055014-62055036 CTACAAATACAGATTAACATTGG + Intronic
931617771 2:64177977-64177999 CTGCAAATACACTTGAAAATGGG + Intergenic
933125084 2:78594640-78594662 CATGAAATACATATTAATATGGG + Intergenic
933233099 2:79831815-79831837 CAGGAAATACAAATAAATATTGG - Intronic
934306176 2:91824074-91824096 CAGCAAATACCCATGTATGTGGG + Intergenic
934327080 2:92028668-92028690 CAGCAAATACCCATGTATGTGGG - Intergenic
934465458 2:94259235-94259257 CAGCAAATACCCATGTATGTGGG - Intergenic
935693301 2:105749094-105749116 CAGGTAATACAGTTGAGTATGGG - Intronic
937071335 2:119065993-119066015 GAGCAATAGCAGATGAATATGGG - Intergenic
937991750 2:127666357-127666379 CAAGAAAAACAGATGAATCTTGG + Intronic
938918102 2:135964283-135964305 CAGAAAATACAGAAAAATACAGG - Intronic
940099372 2:150016496-150016518 CAACAATTACAGGTGACTATGGG + Intergenic
940587630 2:155673938-155673960 CAGCAAATGCTGGTGAAAATAGG + Intergenic
944083177 2:195813081-195813103 CACCAAAGACAGATACATATCGG + Intronic
946905406 2:224411204-224411226 CAGCAAATCCAGATAATTACTGG + Intergenic
1170563609 20:17579995-17580017 CAGAATATAAAGATGAATACAGG - Intronic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1177852316 21:26363334-26363356 AAGTAAATACAGATGAAAACAGG + Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1180040871 21:45279024-45279046 GAGCAAATAGACCTGAATATTGG + Intronic
1180586603 22:16898421-16898443 CAGCAAATACCCATGTATGTGGG - Intergenic
1181393653 22:22602583-22602605 CAGCAAGTCCAGATGGATAAAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182360207 22:29741968-29741990 CAGCTACTAGAGATGCATATAGG - Intronic
1185018749 22:48360902-48360924 CAACAAATACGGATGAATGAAGG + Intergenic
1185203363 22:49522109-49522131 CAGGAAAAACAGCTGAATCTTGG - Intronic
949927668 3:9054943-9054965 CAGCTCATACAGAAGAACATTGG + Intronic
950349450 3:12333450-12333472 CAACAAAAACACAGGAATATAGG - Intronic
953820126 3:46201149-46201171 CAGAAAATATAGACAAATATAGG - Intronic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
956443101 3:69299221-69299243 CAGCATTTACAGATCTATATAGG + Intronic
957329518 3:78743573-78743595 TAGCATATCCTGATGAATATAGG - Intronic
957585322 3:82125142-82125164 CAGAAAATTCAGATGAATTCTGG + Intergenic
958069922 3:88597061-88597083 CAGCACAAACAGACTAATATAGG + Intergenic
959540568 3:107532650-107532672 CAGAAAATACAGAAGACTACAGG + Intronic
959561740 3:107790125-107790147 CACCAAATACAGATGAGAAGAGG - Intronic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960370353 3:116829822-116829844 AAGCAAAAAGAAATGAATATTGG + Intronic
960756103 3:121014735-121014757 CTGCAAATACAGATAAGTACTGG - Intronic
963822120 3:149909044-149909066 CCTCAAATACAGATTAATCTGGG + Intronic
964677527 3:159300340-159300362 CAGGAATTACAGATGAGTCTGGG - Intronic
965341252 3:167493886-167493908 GAGGAAATACAGACGAAGATGGG - Intronic
966505950 3:180701921-180701943 CAGAAAATACAGCTCAACATTGG - Intronic
970197983 4:13572154-13572176 CAGCAAGAAGAGATGAAAATGGG + Intronic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
971804245 4:31334966-31334988 CATCACATACACCTGAATATTGG - Intergenic
971863386 4:32138067-32138089 CTGCAAATACAGATTAGCATTGG + Intergenic
972047020 4:34678872-34678894 CACCAAATAAATATGTATATTGG - Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975893295 4:79055132-79055154 TAGCAAATAAAAGTGAATATAGG - Intergenic
976327529 4:83789513-83789535 CAAGAAATATAGATAAATATTGG - Intergenic
976359347 4:84159360-84159382 CAGCAAATACAGACTCTTATCGG + Intergenic
976975153 4:91157169-91157191 CAACACAAACAGATGAATTTAGG - Intronic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978767267 4:112416974-112416996 CAGAAAAGACAGATTAATATAGG + Intronic
979221044 4:118225233-118225255 CAGCATATTCAGATGACTCTGGG + Intronic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
980501268 4:133657306-133657328 CAATAAATACATATGAATAAAGG + Intergenic
981116442 4:140996119-140996141 TAGCAAATACTGATGAGGATGGG - Intronic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982658482 4:158177919-158177941 TACCAGATACAGATGAATAAAGG - Intergenic
983431951 4:167661330-167661352 CAGAAAATAAAAATGAATTTTGG + Intergenic
984787530 4:183582782-183582804 CAGCACATACTGATCAATCTCGG - Intergenic
989221725 5:38973445-38973467 CAGCAAATACAGTAAAATCTAGG + Intronic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
990719776 5:58681291-58681313 CAATCATTACAGATGAATATTGG + Intronic
991342996 5:65632397-65632419 AATCAGCTACAGATGAATATGGG - Intronic
991944829 5:71889996-71890018 CAGCAAGTACAGAGATATATTGG + Intergenic
991950365 5:71941655-71941677 CAGGAATTAAAGATGAATCTGGG - Intergenic
992752809 5:79876381-79876403 CAGGAAATACATGTGAATAAAGG + Intergenic
993011308 5:82486351-82486373 TGGCAAAGACAGATGAAAATTGG + Intergenic
994653747 5:102562785-102562807 CAGCAGAAACAGATTAATAGAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995248325 5:109960964-109960986 CAGATAATACAGATTAATATAGG + Intergenic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
996514227 5:124351975-124351997 GAGTAAATACTGATGAATTTTGG - Intergenic
998220627 5:140275700-140275722 TAGCAAATACTAATGAAAATGGG + Intronic
998464655 5:142333771-142333793 CAGTAAATACTGATGAATGAAGG - Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1001847155 5:174932468-174932490 CAGCAAAAACAGACTAAGATGGG - Intergenic
1003066404 6:2906953-2906975 CAGCAAATACAGTTGTCTCTTGG - Intergenic
1004242050 6:13932974-13932996 CAGCAATTTCAAATCAATATGGG - Intronic
1004576146 6:16897147-16897169 CAGCAAATAAAGAAGCATTTAGG - Intergenic
1004618291 6:17311177-17311199 CAGCACATAATGATGAATACTGG - Intergenic
1007542263 6:42658440-42658462 CAACAAATAGAGATAAATAGTGG - Intronic
1009585743 6:65599374-65599396 CAGCCAATAGAGATAAATGTGGG - Intronic
1011173770 6:84537146-84537168 CAGGATAAACAAATGAATATTGG + Intergenic
1011388202 6:86820679-86820701 CAGCAACTAGAGAAGCATATTGG - Intergenic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1014525739 6:122499763-122499785 CAGCAAAAAGAGATGAAATTTGG - Intronic
1014887127 6:126795489-126795511 CAGCAAATACAGAAGAACTGGGG - Intergenic
1015014138 6:128389723-128389745 AAGGAAATAAAAATGAATATAGG - Intronic
1017558040 6:155594354-155594376 CACCAAATACATAAGAATGTAGG + Intergenic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1019146453 6:169978325-169978347 TAGTAATTACAGTTGAATATGGG + Intergenic
1019745292 7:2696555-2696577 CAGCAGATAAAAATGACTATTGG - Intronic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1021433255 7:20585195-20585217 TAGCAAATCCAGATGCATATTGG - Intergenic
1023174204 7:37419960-37419982 CAGCAATTACAAATGATGATAGG - Intronic
1024321119 7:48070721-48070743 CAGTAAACACTGTTGAATATAGG - Intergenic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1025738599 7:64176889-64176911 CAGTAAAAAGAGATGAAAATTGG + Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026416396 7:70185407-70185429 CAGAAAAAACAGTTGAATGTTGG - Intronic
1028390467 7:90310878-90310900 AAGCAAGTATATATGAATATTGG + Exonic
1029642959 7:101832584-101832606 AAGCAAATAGGGATGAATAAAGG - Intronic
1029714460 7:102318469-102318491 CAGCAAAGGCAAATGATTATGGG + Intronic
1031655594 7:124350713-124350735 CTGCAATGACAGTTGAATATGGG - Intergenic
1032327170 7:130940537-130940559 GAGCAAATAGAGATGAAGAGTGG - Intergenic
1032571151 7:132999157-132999179 CTGGAAATGCAGATAAATATTGG - Intronic
1032824457 7:135555556-135555578 CAGAAACTAGAGATGACTATAGG + Intergenic
1035531929 8:359577-359599 GAGCAAATAAAGAGGAATAGAGG - Intergenic
1037813940 8:22102236-22102258 CAGCAGGTACTCATGAATATGGG - Exonic
1039026652 8:33266029-33266051 CAGCAAATAAAGATCCATCTAGG - Intergenic
1039533294 8:38284118-38284140 CTGCAGTTACAGATGAATTTTGG - Intronic
1040625023 8:49137756-49137778 CAAGAAAAACAGCTGAATATTGG + Intergenic
1041236673 8:55809804-55809826 AAAGAAATACAGATGAAAATAGG + Intronic
1044158007 8:88874423-88874445 CAACAAATGCAAATTAATATTGG - Intergenic
1046612547 8:116442058-116442080 CAGGGAATAAAGATGAATAGTGG - Intergenic
1046807076 8:118490731-118490753 CAGGAAATAAAGAAGAAAATGGG + Intronic
1047147810 8:122224676-122224698 CAGGAAATACACATTATTATTGG - Intergenic
1049776443 8:144408034-144408056 CAGCAAATACATATGTATGCCGG + Intronic
1050702678 9:8358773-8358795 CAGAAAATAAAGTTAAATATTGG - Intronic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051828105 9:21244083-21244105 CAGGAAACACAGGTGAATAAAGG - Intergenic
1053336800 9:37281747-37281769 CAGCATATACACATTAATAATGG + Intronic
1053695522 9:40636014-40636036 CAGCAAATACCCATGTATGTGGG - Intergenic
1053942514 9:43267063-43267085 CAGCAAATACCCATGTATGTGGG - Intergenic
1054306768 9:63435238-63435260 CAGCAAATACCCATGTATGTGGG - Intergenic
1054405503 9:64759228-64759250 CAGCAAATACCTATGTATGTGGG - Intergenic
1054439127 9:65244717-65244739 CAGCAAATACCTATGTATGTGGG - Intergenic
1054491279 9:65777224-65777246 CAGCAAATACCTATGTATGTGGG + Intergenic
1054736809 9:68761430-68761452 CAGCAATAAGAAATGAATATAGG - Intronic
1055235381 9:74116110-74116132 CAGCAAATACATATGCAAAAGGG - Intergenic
1055722228 9:79188199-79188221 CAGTACTTACAGATGAATTTAGG - Intergenic
1055910147 9:81341341-81341363 CATTAAATATAGATCAATATGGG - Intergenic
1058170967 9:101680789-101680811 CAGCAAATACATGTGAACAAAGG + Intronic
1060143601 9:121232096-121232118 CAGCTATTCCAGATTAATATGGG + Intronic
1060751418 9:126172032-126172054 TAACAATTACAGATCAATATTGG - Intergenic
1061539404 9:131269775-131269797 CAGCACATAAAGATGCACATGGG - Intronic
1202777966 9_KI270717v1_random:9630-9652 CAGCAAATACCCATGTATGTGGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186514638 X:10157910-10157932 TGGCAAATACAAATTAATATTGG + Intronic
1186987675 X:15034324-15034346 CAGCATATACATCTGTATATAGG - Intergenic
1188199090 X:27277721-27277743 CAGAGACTACAGATGACTATGGG + Intergenic
1188202716 X:27310888-27310910 CAGAAAATACAGTTTAAAATGGG - Intergenic
1188311120 X:28617679-28617701 TAGGAAATACAAATGATTATAGG + Intronic
1188648199 X:32595252-32595274 AAACAAATACAGAAGAGTATAGG + Intronic
1188882787 X:35510649-35510671 TGGCAAATACAGATGACTTTGGG - Intergenic
1189713826 X:43844266-43844288 CAGGAAATCCAGATGCATAAGGG - Intronic
1195620084 X:106944154-106944176 CAAAAAATACAGAGAAATATGGG - Intronic
1197127468 X:122964396-122964418 TGGAAAATACAGATGAATACAGG + Intergenic
1197604642 X:128571040-128571062 CTTCAAATACAGATGGATGTGGG - Intergenic
1197654159 X:129098282-129098304 CAACAAAAATAAATGAATATTGG + Intergenic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1198138864 X:133782694-133782716 CTTCAAATACAAATGAATTTTGG + Intronic
1199543776 X:148986010-148986032 CAGCACATACAGATGATTTGGGG - Intronic