ID: 908825591

View in Genome Browser
Species Human (GRCh38)
Location 1:68129986-68130008
Sequence TGTGAAATGAGACCAATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908825591 Original CRISPR TGTGAAATGAGACCAATCTC TGG Intronic
900731243 1:4262214-4262236 TCTGAAATAAAACCAATATCAGG + Intergenic
902524891 1:17050216-17050238 TGTGAAATAAGAGCAATGCCAGG + Intronic
902838513 1:19061058-19061080 TCTGCAATGAGATAAATCTCTGG + Intergenic
903429773 1:23286341-23286363 TGTGAAATGTTAACAATATCAGG + Intergenic
904209495 1:28877333-28877355 CGTGAAATGAGCCCGGTCTCGGG - Intergenic
905635965 1:39552600-39552622 TGTGAAATGAGAAGGATGTCTGG + Intergenic
908469751 1:64432207-64432229 TGTGAAATAATAGCAATCACGGG - Intergenic
908825591 1:68129986-68130008 TGTGAAATGAGACCAATCTCTGG + Intronic
911243594 1:95491960-95491982 TGTGAAATGAGAGCAATAGCTGG + Intergenic
916292635 1:163183430-163183452 TGTAAAATGAAAGCAATTTCAGG - Intronic
916583899 1:166132960-166132982 TGGGATATGAGAACAATCTCTGG + Intronic
916858716 1:168779524-168779546 TGTGGAATGTGACCACTCTTGGG + Intergenic
917727598 1:177842275-177842297 TATGAAAAGAGCCCAAACTCTGG - Intergenic
923905671 1:238381394-238381416 TGTAAAATGATATTAATCTCTGG - Intergenic
1062826420 10:572064-572086 TCTGAAAGGAGACCCTTCTCGGG + Intronic
1064549152 10:16481105-16481127 TGTGAAATTTGAACAATCTGAGG - Intronic
1071115844 10:82218933-82218955 TAAGAAAGGAGACCAATCTATGG + Intronic
1071581246 10:86772428-86772450 TGTGAAAAAAGATCTATCTCTGG - Intronic
1073193660 10:101670350-101670372 TGGGAAATGATGCCTATCTCAGG + Intronic
1073544500 10:104337355-104337377 TGTGAAATGAGACCAGTATCTGG + Intronic
1073598410 10:104822788-104822810 TGATATATGGGACCAATCTCTGG + Intronic
1074213814 10:111364495-111364517 TATGAAATGACACCAAACCCGGG - Intergenic
1074240386 10:111633033-111633055 AGTGAAATGAGCCCAGTCTCTGG - Intergenic
1074772704 10:116743613-116743635 TGGGAAATGCCACCCATCTCTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081487065 11:43538904-43538926 TTTGAAAAGAGACCTTTCTCAGG + Intergenic
1083938745 11:65883791-65883813 TGGGAACTGAGACATATCTCAGG - Intronic
1085459297 11:76683594-76683616 TGTGAAAACAGACCAATGTAGGG + Intergenic
1086610380 11:88748438-88748460 TGGGAACTCAGACCCATCTCAGG - Intronic
1086924529 11:92625808-92625830 TGACAAATGAGAGAAATCTCAGG - Intronic
1087985025 11:104668064-104668086 TGTTAAATGTAACAAATCTCTGG - Intergenic
1089694488 11:120208794-120208816 TGTGAACAGAGACAAACCTCAGG + Intergenic
1091689127 12:2583843-2583865 TGTGAAATGATATGAATGTCTGG + Intronic
1091761643 12:3091406-3091428 TGTGAAATGTCACCAATGGCAGG + Intronic
1092032820 12:5302687-5302709 TGAGAACTGAGAGAAATCTCCGG + Intergenic
1092068641 12:5614396-5614418 TGTGATACTAGCCCAATCTCAGG + Intronic
1092514181 12:9190821-9190843 TGTGAAAAGAGAACAATATGAGG + Intronic
1093600812 12:21020064-21020086 TGTAAAATGTAACCAATTTCTGG - Intronic
1093702643 12:22239880-22239902 TTAGAAAAGAGACCAATCTCTGG - Intronic
1099992306 12:89737156-89737178 TGTGAAATAAGACTAGTCTGTGG + Intergenic
1100986097 12:100202990-100203012 TTTGAAATGAAACTATTCTCAGG + Intronic
1101403609 12:104409514-104409536 TGTGAAATGACACCATTCCGAGG - Intergenic
1105689725 13:22823971-22823993 TGTCTAATGAGCCCAATGTCTGG - Intergenic
1108495450 13:51020091-51020113 TGAGTAATGAGGCCAGTCTCAGG + Intergenic
1109929957 13:69202751-69202773 TGTGAGAAGGGGCCAATCTCAGG - Intergenic
1110835534 13:80077915-80077937 TGTGAAATGGGACCAATAGGAGG + Intergenic
1111110443 13:83701493-83701515 TGTGAGATAAGACCAAACACAGG - Intergenic
1111151280 13:84256475-84256497 AATGAAATGAGACAAAACTCCGG - Intergenic
1114377746 14:22167020-22167042 AGTGAAATGAGGCCAACCTTGGG + Intergenic
1115353226 14:32419667-32419689 TGTGAAATAAGCCTGATCTCAGG - Intronic
1118197976 14:63645856-63645878 TGTGAAAAGAAAATAATCTCAGG + Intergenic
1121991251 14:98559827-98559849 TGTGGAAGGGGACCAATCACAGG - Intergenic
1125275274 15:37982347-37982369 TGTGGAGTGAGATCTATCTCTGG - Intergenic
1125622025 15:41071759-41071781 TGTGAAATGAGTACAAGATCTGG - Intronic
1127490771 15:59460693-59460715 TTTGAAATGAGACCAATAAAAGG + Intronic
1129120939 15:73396185-73396207 TGACAAATGAGAACAGTCTCTGG - Intergenic
1131581946 15:93651953-93651975 TCTGAAGTGAGAACAATCTTTGG + Intergenic
1132145060 15:99424726-99424748 TGTGAAATGAGGCTAATGTTTGG + Intergenic
1133590067 16:7233501-7233523 TGTTAAATGAGATCAATGTGTGG + Intronic
1135408423 16:22215053-22215075 TGTGGAATGCGACCAATCAGAGG + Intronic
1135676176 16:24416995-24417017 TGTGAAATGTGTACAGTCTCAGG - Intergenic
1137845245 16:51681364-51681386 TGTGGAAAGAGACCAATCAGAGG - Intergenic
1141058464 16:80841136-80841158 TGAGCAATGATACCAATCTCAGG + Intergenic
1145363249 17:22229534-22229556 TGGGCAATGAGAGCAAACTCTGG + Intergenic
1147507729 17:41036642-41036664 TGTGTCATGACAACAATCTCGGG + Intergenic
1147991131 17:44334180-44334202 TGTGAATGGAGATCATTCTCTGG + Intergenic
1151394395 17:73812527-73812549 TGTAAAATGTGCCCAATTTCTGG - Intergenic
1153819534 18:8821332-8821354 TGTGCACTGAGGCCAAGCTCTGG - Intronic
1155645449 18:28071800-28071822 TGTGAAAAGAAACCAAACTTGGG - Intronic
1157634972 18:49143524-49143546 AGTTAAATAAGACCAATATCCGG - Intronic
1159366623 18:67474545-67474567 TGTGACATGGGACAAGTCTCTGG + Intergenic
1163608681 19:18290148-18290170 TATGAAATGAGAGCAAAGTCAGG + Intergenic
1164098814 19:22036027-22036049 TGTGTATTGTGACAAATCTCTGG - Intergenic
926630029 2:15127805-15127827 TGTGATTTGAGCCCAATCTTGGG - Intergenic
927048168 2:19300980-19301002 TGAGAAATGAGAACATACTCAGG + Intergenic
928065708 2:28162487-28162509 TGTGTAATGAGACTACTGTCTGG + Intronic
928562302 2:32503003-32503025 TATGAAATGAAATCGATCTCAGG - Intronic
931070858 2:58647963-58647985 TTTGAAATGATACCAGTGTCTGG + Intergenic
932408499 2:71530282-71530304 TGCGAAATAAGAACAATCTCAGG - Intronic
932915881 2:75857298-75857320 TTTGAAATTAGAACATTCTCAGG + Intergenic
936843357 2:116801346-116801368 TGTGAAATGGTACGATTCTCTGG + Intergenic
936966092 2:118128865-118128887 TGTGAAATGGGAATAATCTTAGG - Intergenic
940476143 2:154165767-154165789 AGTGAAATTAGACCAAGATCTGG + Intronic
940866479 2:158822693-158822715 TGTGAAATGACAAAAATGTCAGG + Intronic
946430235 2:219622402-219622424 TTTGAAATAAATCCAATCTCAGG - Intergenic
947250423 2:228096726-228096748 TATGAAATGAAAGCAGTCTCTGG + Intronic
1169301704 20:4446995-4447017 TGTGAAAAGAGAACAAACACTGG + Intergenic
1169525412 20:6419525-6419547 TGAGAATGGAGACCAATTTCAGG - Intergenic
1170220987 20:13941276-13941298 TGTGAAATGTGCACAGTCTCAGG - Intronic
1170407217 20:16050831-16050853 TTTCAAATGAGACCACTCTGTGG - Exonic
1170731745 20:18982275-18982297 TGAGAAATGAGGCCAGTCTTGGG - Intergenic
1171442720 20:25178246-25178268 GGTGAAATGAGAACAACCGCAGG + Intergenic
1173852626 20:46228479-46228501 TGTCAAATTAGAGCCATCTCTGG - Intronic
1174481876 20:50837110-50837132 TGTAAAATGAGACTAATAGCAGG - Intronic
1175328459 20:58146166-58146188 TGTGAAAAGAGAAGAACCTCTGG + Intergenic
1177925390 21:27207935-27207957 TATGAAATGAGACTACACTCTGG - Intergenic
1178708805 21:34896271-34896293 AGTGAGAAGAGACCATTCTCAGG + Intronic
950236164 3:11322081-11322103 AGTGAGATGAAACCAATCACAGG - Intronic
951956267 3:28257887-28257909 TGTGAAATGATACATTTCTCTGG - Intronic
953076251 3:39573150-39573172 TGAGAAATGAATCCATTCTCAGG - Intergenic
953078245 3:39591496-39591518 AGTCAACTGTGACCAATCTCAGG + Intergenic
957819274 3:85349181-85349203 TGTGAACAGAAAACAATCTCTGG - Intronic
963774043 3:149420506-149420528 TGTGGAAAGAGAGAAATCTCTGG - Intergenic
964425922 3:156554026-156554048 TCTAAAATGAGAACAAACTCTGG + Intronic
965183677 3:165436218-165436240 TCTCAAAAAAGACCAATCTCAGG - Intergenic
967347829 3:188478301-188478323 TGTAAATTGAGACCTATTTCTGG + Intronic
969472465 4:7397367-7397389 TGCTAAATGAGGCCAAGCTCAGG + Intronic
971815885 4:31488246-31488268 TGTGAGAATAGACAAATCTCTGG + Intergenic
971926351 4:33014105-33014127 TGTGAAGTGAGATAAAACTCTGG - Intergenic
973093035 4:46162115-46162137 ACTAAAATGAGACCAATCCCGGG + Intergenic
975002300 4:69239636-69239658 TGTGAAATGACAACGCTCTCGGG - Intergenic
975949374 4:79749338-79749360 TCTGAAATGATAAAAATCTCTGG + Intergenic
976395470 4:84550522-84550544 TGGGAACTCAGACCCATCTCAGG - Intergenic
978547006 4:109880612-109880634 TGTGAAGTGAGACCACTGGCTGG - Intergenic
980554673 4:134387431-134387453 TGTGAAATGAGAGAATTCCCTGG - Intergenic
983860117 4:172695569-172695591 CATGAAATGAGAGAAATCTCAGG - Intronic
984346459 4:178533779-178533801 TGTGAAATGAAATAAATCACTGG - Intergenic
985074609 4:186201621-186201643 GGAGAACTGAGAGCAATCTCTGG - Intronic
993856754 5:93086021-93086043 CATGAAATGAGAAGAATCTCAGG - Intergenic
994721819 5:103389446-103389468 TGTGAAATGACACCAGAATCTGG - Intergenic
996516383 5:124373918-124373940 TGTCAAATGAGAATAATATCTGG - Intergenic
997787724 5:136728816-136728838 TGTGAAATGAGGCCAAGCAGGGG + Intergenic
997854277 5:137359076-137359098 TGTGAAATAAGACCTATATTAGG + Intronic
997862334 5:137429155-137429177 ACTGAAAGGAGACCAATCTGTGG - Intronic
998689950 5:144576639-144576661 TGAGAAAAGAGACGAATCCCTGG - Intergenic
1000060177 5:157647985-157648007 TGTGTAATCAGAACAATCACTGG + Intronic
1000248173 5:159467727-159467749 ACTGAAATCAGACCAACCTCTGG - Intergenic
1001816038 5:174670368-174670390 TGTATAAAGAGACCAATTTCTGG - Intergenic
1003684674 6:8290045-8290067 AGTGATATGAGACCAAGGTCTGG + Intergenic
1004482208 6:16031742-16031764 TGTGAAATGAAAACCCTCTCAGG + Intergenic
1007898001 6:45382392-45382414 TGTGGAAGGAGACCAAGCACAGG + Intronic
1007985540 6:46204082-46204104 TGTGGAAAGAGAGCAGTCTCTGG + Intergenic
1009376048 6:62970856-62970878 TCTAAAGTGAGACCAACCTCAGG + Intergenic
1011989373 6:93494132-93494154 TGTGAAATGAGACCTTTCAGAGG + Intergenic
1013861161 6:114637185-114637207 TGTTTGATGAGACCACTCTCAGG - Intergenic
1014586955 6:123210190-123210212 TATGAAATAAGACCAAACGCAGG + Intergenic
1017699529 6:157054915-157054937 TGTGAAAAGAGACCCACCACTGG - Intronic
1020435563 7:8158712-8158734 GGTGAAATGAGACCAACAGCAGG + Intronic
1020925636 7:14320387-14320409 TGTCAACTGAGAACAAGCTCTGG - Intronic
1023544778 7:41306916-41306938 TGTGAAAAGAGACACATATCTGG - Intergenic
1024987672 7:55209342-55209364 TTTGAAATGAGCCAAGTCTCAGG - Exonic
1036984680 8:13515191-13515213 TTTGAAATGAGAGCAAGCACAGG - Intronic
1041803138 8:61821723-61821745 TGTGAATTGATACTAATTTCTGG - Intergenic
1043083197 8:75793141-75793163 TGTGAAACGAGAACAATGTAGGG + Intergenic
1043545985 8:81316255-81316277 TGTGAAATGTGTGCATTCTCAGG + Intergenic
1043863776 8:85352565-85352587 TGTGAAATAAGACCAACCACAGG - Intronic
1043973773 8:86562749-86562771 TGGGAAAGGAGAGCTATCTCTGG + Intronic
1048464005 8:134648094-134648116 TGTGAAATGATACCACAATCAGG - Intronic
1050200379 9:3139150-3139172 TGAGAAAAGATACCAAGCTCAGG - Intergenic
1050783295 9:9366990-9367012 AGTAAAATGAAACAAATCTCAGG + Intronic
1051092193 9:13423255-13423277 TGTGAAATGGGACTAATATTAGG + Intergenic
1052642519 9:31187680-31187702 TGTGAAATAAGAACTATTTCTGG + Intergenic
1052649546 9:31283697-31283719 TGTGGAAAGAGAGAAATCTCTGG - Intergenic
1057018571 9:91677869-91677891 TGTGAAATGAAACGTTTCTCGGG - Intronic
1058917980 9:109586010-109586032 TGTGGAAGGAAAACAATCTCAGG + Intergenic
1059161862 9:112042052-112042074 TGTTAAATGGGGCCAAGCTCTGG - Intronic
1185982962 X:4799425-4799447 TCTCAAATTAGACCCATCTCCGG - Intergenic
1186764022 X:12752434-12752456 AGTGCACTGAGACCAACCTCGGG - Intergenic
1188102267 X:26103640-26103662 TGTGAAAAGAAGCCATTCTCAGG - Intergenic
1189090976 X:38082339-38082361 TGTGACATGTTACCACTCTCAGG + Intronic
1190519380 X:51261869-51261891 TGTCTAATGAGACCAACATCTGG - Intergenic
1191037698 X:56044714-56044736 TGGGAAGTCAGACCCATCTCAGG + Intergenic
1191229236 X:58081044-58081066 AGAGAAACGAGACCAAGCTCAGG + Intergenic
1195022768 X:100846264-100846286 TGTGAAATGATACCACACTCGGG - Intronic
1198810444 X:140530837-140530859 TTTGAAATCAGACCAATCTAAGG - Intergenic
1199056640 X:143304194-143304216 AGTGAAATGACAGCATTCTCAGG - Intergenic
1201409853 Y:13688506-13688528 TGAGATATAAGCCCAATCTCTGG - Intergenic