ID: 908829570

View in Genome Browser
Species Human (GRCh38)
Location 1:68165596-68165618
Sequence ATATGAACAGAGCTTGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908829570 Original CRISPR ATATGAACAGAGCTTGAGCT CGG Intronic
903190636 1:21653758-21653780 ATGTGCACAGTGCTTGGGCTGGG + Intronic
903305543 1:22410369-22410391 ATATGGACAGAGCTGGAGATTGG + Intergenic
904796002 1:33056967-33056989 ACATGACCAGTGCCTGAGCTGGG + Intronic
907091832 1:51732076-51732098 ATATCAACAGAGATTGAAGTGGG - Intronic
908829570 1:68165596-68165618 ATATGAACAGAGCTTGAGCTCGG + Intronic
908922722 1:69215527-69215549 ATATGAAGTGAGGCTGAGCTGGG + Intergenic
910515188 1:88053011-88053033 ATGTGAACAAAGCTTTAGTTAGG - Intergenic
913214541 1:116609601-116609623 AGAGGAACAGAGCTAGAACTGGG - Intronic
914406748 1:147382467-147382489 ATGTGGACAGATCTTGACCTTGG + Intergenic
915852500 1:159340691-159340713 ATATGATGAGAGCTGGAACTAGG - Intergenic
915929692 1:160052366-160052388 AGAAGAACAGAGCTGGATCTGGG - Intronic
916535682 1:165701055-165701077 AAACTAACAGAGATTGAGCTAGG + Intergenic
916659007 1:166903788-166903810 AAGTGAACAGTGCTTGAGGTAGG - Intergenic
917456222 1:175188303-175188325 ATCTGAACAGAGCATCATCTGGG - Intronic
920103993 1:203537534-203537556 AGATGCCCAGGGCTTGAGCTAGG + Intergenic
920416732 1:205804002-205804024 ATAGGTACAGAGCTTCAGCTGGG + Intronic
920989089 1:210918998-210919020 ATTTGAACATAGCTGTAGCTTGG - Intronic
921796684 1:219352773-219352795 GGATGAACAGAGCCTAAGCTGGG - Intergenic
922086198 1:222349444-222349466 ATATGAACAGCAGTTGAGCATGG + Intergenic
923246951 1:232141411-232141433 ATAGGAACAGAGTTTCAGTTTGG + Intergenic
923350332 1:233098794-233098816 ATATGACCAGAGGTAGAGGTGGG - Intronic
1065471960 10:26091274-26091296 ATGTGGTCAGAGATTGAGCTGGG - Intronic
1066544803 10:36488341-36488363 ATGTGTACAGAGCTTCAGTTTGG - Intergenic
1069045948 10:63743103-63743125 AGAGGGACAGAGCTTGAGCTGGG + Intergenic
1071992657 10:91115154-91115176 AGATCAACAGAGCTTGACTTGGG + Intergenic
1074270801 10:111951691-111951713 ATGTCCACAGAGCTTGATCTTGG + Intergenic
1074533262 10:114311186-114311208 AGAGGAACAGAGCCTGGGCTGGG + Intronic
1074542443 10:114376269-114376291 CTATGACCAGACCTTGTGCTCGG + Intronic
1074739242 10:116468645-116468667 AAAAGAACAGTCCTTGAGCTGGG - Intronic
1075717358 10:124564611-124564633 ATATGAACAGAGCCCCTGCTAGG + Intronic
1076698670 10:132259002-132259024 ACATGAACAGGGCTATAGCTTGG + Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078858508 11:15226148-15226170 ATCTGAACAGAGATTGAGGAAGG - Intronic
1083367178 11:62148412-62148434 ATGGGAACAGGGCTTGGGCTGGG + Intronic
1084080841 11:66823523-66823545 TTAAGAACAGAGCTAGGGCTGGG + Intronic
1087029539 11:93689093-93689115 AAATGAACATGGCTTAAGCTAGG - Intronic
1088251981 11:107869112-107869134 GGATTAAAAGAGCTTGAGCTAGG + Intronic
1088564000 11:111148240-111148262 AAATGAACAGAGCTTCTGCAGGG - Intergenic
1088990522 11:114949608-114949630 AGAGGAAGAGAGCTGGAGCTTGG - Intergenic
1089594568 11:119569111-119569133 ATTTCAACAGAGCTTGAGGACGG + Intergenic
1091950131 12:4585916-4585938 AACTGAAAAGAGCTTTAGCTGGG + Intronic
1098490278 12:71067908-71067930 AATTGAACTGAGTTTGAGCTGGG - Intronic
1098889848 12:75998522-75998544 TTATTAAAAGAGCTTGAGCAAGG + Intergenic
1100545073 12:95593869-95593891 ATAAGAACAGTGCGTGAGGTAGG - Intergenic
1101708918 12:107247033-107247055 ATAGGAACAGAGTTTCAGCTTGG + Intergenic
1102058406 12:109914035-109914057 AGATGACCAGAGGTGGAGCTGGG - Intronic
1103115659 12:118328378-118328400 AAATGACCAGAGTTTGTGCTAGG + Intronic
1105218272 13:18303073-18303095 AGAGGAACAGAGCTAGAACTGGG - Intergenic
1110293926 13:73840434-73840456 ATTTTAATAGAGCTTGAGATGGG - Intronic
1110495033 13:76158275-76158297 AAATGAACACAGCTAGGGCTTGG + Intergenic
1112962643 13:105145587-105145609 TAATGAACACAGCTTGATCTAGG + Intergenic
1113391033 13:109897349-109897371 ATATGAACAGTACTTCTGCTTGG - Intergenic
1113583220 13:111443751-111443773 ATATGAAGAGTTCTGGAGCTGGG - Intergenic
1113706582 13:112437463-112437485 ATATAAGCAGTGCTAGAGCTGGG + Intergenic
1114881455 14:26791079-26791101 ATATGGAGAGAGCTCGAGGTTGG + Intergenic
1117009099 14:51452148-51452170 AGATGATCAGAGCATGAGCGAGG + Intergenic
1118016833 14:61669327-61669349 AAATGATCAGGGCTTGAACTTGG + Intergenic
1118097812 14:62558680-62558702 ATATGTACAGAGCATTAGTTTGG + Intergenic
1121172921 14:91869399-91869421 ATTTGAAGAGAGCTTGTGTTTGG - Intronic
1121844253 14:97159330-97159352 AGATGAACAGTGCTTGTGCAGGG + Intergenic
1122179832 14:99946972-99946994 TTATGAAAAGACCTTGAACTTGG + Intergenic
1130152223 15:81319883-81319905 ATTTGAACAGGGCCAGAGCTAGG + Intronic
1130218307 15:81994907-81994929 AAATGAACAAACCTTCAGCTAGG + Intergenic
1131182797 15:90251966-90251988 ATAGGAAGACGGCTTGAGCTCGG - Intronic
1131345815 15:91647218-91647240 ATAAGAAGAAAGCTAGAGCTGGG + Intergenic
1131799830 15:96057347-96057369 ACATCAACATAGCTTTAGCTTGG - Intergenic
1132394119 15:101459681-101459703 CTATGAACACAGCTCCAGCTGGG + Intronic
1133396268 16:5449906-5449928 ATATGTACAAAGCTAGAGGTGGG - Intergenic
1133473647 16:6098990-6099012 ATATCAACAGAGGATGGGCTGGG + Intronic
1134625125 16:15717991-15718013 ATAAGGTCAGAGCTTCAGCTAGG + Intronic
1135885652 16:26304343-26304365 ATATAAACAGAATTTGATCTCGG - Intergenic
1135959653 16:26985036-26985058 ACATGAAAAGAGCCTGAGATTGG + Intergenic
1136405027 16:30040168-30040190 ATATGAAAAGATCCTGAGCTGGG + Intronic
1137496712 16:48975024-48975046 TTATGAACGGAGCTTAACCTTGG + Intergenic
1138301843 16:55937155-55937177 AAATGCACAGATCTTGAGGTGGG - Intronic
1138483800 16:57322454-57322476 ATAAGAACAGAGTTGGGGCTGGG + Intergenic
1139590758 16:67931581-67931603 ATAGGACCAGAGATTGAGCCAGG - Intronic
1141145680 16:81528461-81528483 ATATGACCAGAGGTGGAGCGTGG + Intronic
1143897518 17:10147766-10147788 ACATTAATAGAGTTTGAGCTTGG - Intronic
1145735682 17:27229744-27229766 ATATAAACGGAGCATGGGCTGGG + Intergenic
1145869223 17:28259802-28259824 ACAAGAACACAGCTTGGGCTGGG - Intergenic
1147344225 17:39777545-39777567 ATTTTAACAGAGGTTAAGCTAGG + Intronic
1147923069 17:43930449-43930471 ACAAGAACACAGCTTGGGCTGGG + Intergenic
1148963209 17:51410791-51410813 AAATGAACTGAGCTTGAGTGAGG + Intergenic
1150191720 17:63248295-63248317 ATATGAAGTGAGCTTGAAATAGG + Intronic
1151243892 17:72779550-72779572 AGGTGAACAGCGCTTGTGCTGGG - Intronic
1151997422 17:77618689-77618711 ATGTTAGCTGAGCTTGAGCTTGG - Intergenic
1157237770 18:45980481-45980503 ACTTGAACAGCGCCTGAGCTAGG + Intergenic
1157790565 18:50527632-50527654 ATATGAACACAGAGTGAGCTAGG + Intergenic
1158932964 18:62339043-62339065 ACAAGAACAGAGCCTGGGCTAGG - Intronic
1158951453 18:62499213-62499235 TCATGAACAGATCTTGATCTGGG - Intergenic
1161260406 19:3334749-3334771 CTATTAACAATGCTTGAGCTGGG - Intergenic
1164792231 19:30997046-30997068 CTGTGCACAGTGCTTGAGCTTGG - Intergenic
1165245492 19:34496262-34496284 ATAAGAAGATAGCTTGAGCCAGG - Intronic
1165710336 19:38006218-38006240 ATATAAAAAGAGCCTGAGGTGGG + Intronic
925905751 2:8538917-8538939 AGCTGAACAGCTCTTGAGCTGGG - Intergenic
926651439 2:15351081-15351103 ATATGAACACTGATTGACCTTGG - Intronic
929102077 2:38324906-38324928 ATGGGCACAGAGCTTCAGCTGGG + Intronic
930106683 2:47645781-47645803 TTATAAAAAGGGCTTGAGCTGGG + Intergenic
934296027 2:91743559-91743581 AGAGGAACAGAGCTAGAACTGGG + Intergenic
934486438 2:94717182-94717204 ATATGCACATGGCTTGACCTTGG + Intergenic
937799396 2:126064270-126064292 ATAGCAGCAGAACTTGAGCTGGG - Intergenic
937924802 2:127159729-127159751 ATATGAAGAGAGTTGTAGCTGGG - Intergenic
938115419 2:128599923-128599945 ATGGGACAAGAGCTTGAGCTTGG + Intergenic
939441873 2:142260529-142260551 CTATGGCCAGAGCTTGAGCAAGG - Intergenic
946984343 2:225255526-225255548 ATTTGAACAGAGCTGGAACTAGG + Intergenic
946993691 2:225365991-225366013 ATAGGTACAGAGTTTCAGCTTGG - Intergenic
947855584 2:233321631-233321653 ATGGGAACAGAGCTTCAGATTGG + Intronic
948511757 2:238471491-238471513 ATATCAACAAACCTTTAGCTAGG - Intergenic
1169593374 20:7170463-7170485 CTAGGAACAGAGCTTGAGACTGG + Intergenic
1172218364 20:33252533-33252555 ATAAGAACAGGTCTTGGGCTTGG - Intergenic
1173017886 20:39243567-39243589 AGATGATTGGAGCTTGAGCTGGG + Intergenic
1173296087 20:41759436-41759458 CTAGGAGCAGAGCTTGAGATGGG - Intergenic
1179530475 21:42015152-42015174 AAATGAAAAGATCTTGAGATGGG - Intergenic
1181116532 22:20635418-20635440 ATATGACCAGGGTCTGAGCTGGG - Intergenic
1182159944 22:28111635-28111657 TTACGAACAGAGCCGGAGCTGGG + Intronic
1183297593 22:37040497-37040519 CAAGGAACAGAGCTAGAGCTGGG - Intergenic
1183997342 22:41645003-41645025 ATAAAAACTGACCTTGAGCTGGG + Intronic
1184970966 22:48019580-48019602 AAATGAAAAGAGCTTGATTTTGG + Intergenic
949213428 3:1534530-1534552 GTATGAAAAGACCTTGTGCTGGG - Intergenic
949723482 3:7017420-7017442 ATATCAACAGGCCATGAGCTGGG + Intronic
951954385 3:28238941-28238963 ATATGAAAAGAGCCTCAACTGGG - Intergenic
953205350 3:40822844-40822866 ATACAAACAGAGCTTGAAATTGG - Intergenic
953408695 3:42675161-42675183 ATATGTACAGAGTTTCAGTTTGG - Intergenic
953602688 3:44383569-44383591 ATGTGTACAGAGTTTGAGTTGGG + Intronic
955048159 3:55379754-55379776 ATGGGAGGAGAGCTTGAGCTGGG + Intergenic
955189869 3:56751174-56751196 ATATGAACAGGGCTGGAAGTAGG + Intronic
955563247 3:60215798-60215820 ACATGTACAGAGCCTGGGCTTGG + Intronic
962106902 3:132399672-132399694 ATTTGGACAGAGTTTTAGCTAGG - Intergenic
962783913 3:138748426-138748448 ATAGTAAAAGAACTTGAGCTTGG - Intronic
963242778 3:143025981-143026003 ATATGAACGTAATTTGAGCTGGG + Intronic
964559020 3:157973307-157973329 TTAAGAACAGAGCCTGAGCCAGG + Intergenic
964637078 3:158869769-158869791 ATAAGAGAAGAGCTTGGGCTGGG - Intergenic
965539288 3:169856216-169856238 ATATAAACAGTGGTTGTGCTGGG - Intronic
971379206 4:26081403-26081425 ACCTGAGCAGAGCTTGAGGTTGG + Intergenic
971957912 4:33446316-33446338 AGATGGACAGAGGTTGAGCCTGG - Intergenic
972818596 4:42673238-42673260 ATAAGAACAGAGCTCAAGCGCGG - Intergenic
975493116 4:75010381-75010403 ATAGGCACAGAGTTTGAGTTTGG + Intronic
976496447 4:85735358-85735380 ATTTGAACAAAGCTAGAACTTGG - Intronic
976497252 4:85744579-85744601 AGATAAAGAGAGGTTGAGCTGGG + Intronic
976709237 4:88051282-88051304 ATGAGAACAAAGCATGAGCTTGG - Intronic
976783649 4:88790922-88790944 AAATGAAAAGACCTTGAACTAGG - Intronic
978119889 4:105065714-105065736 CTCTGCACAGAGCTTGAGCTGGG - Intergenic
978901310 4:113952782-113952804 ATAAGAACAGAGATAGAGCTGGG + Intronic
979037280 4:115737931-115737953 ATATACCCAGAGCTTTAGCTGGG - Intergenic
980941663 4:139280338-139280360 ATAGCAACAGAGCTGGAGATGGG - Exonic
982703244 4:158679302-158679324 AGATGAACAGAGCCTGAGAAGGG + Intronic
983985445 4:174053945-174053967 CTATGAACAGAGCTTTGGGTGGG - Intergenic
985519941 5:369458-369480 AGATGAACAGACCTACAGCTAGG + Intronic
985974931 5:3410563-3410585 ATATTAAAAGAGCTTGGGGTGGG - Intergenic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
989251599 5:39322574-39322596 AAATGAACAAACCTTTAGCTAGG + Intronic
991610725 5:68447141-68447163 CTATTAAAAGAGCTTGAGATTGG + Intergenic
992975177 5:82109343-82109365 ATATGCACAGAGCTTTAGTTGGG + Intronic
993842868 5:92901798-92901820 AGATGAACAGAGTTTGAATTTGG + Intergenic
994313329 5:98302884-98302906 ATATGAACAGAGGTTTTTCTAGG - Intergenic
994810319 5:104509445-104509467 ATAGGCACAGAGTTTGAGTTTGG - Intergenic
995076250 5:107987593-107987615 ATATGCAAAGAGCATGAGCAGGG - Intronic
995984808 5:118157209-118157231 TTATGAACAGGGTTTGGGCTTGG + Intergenic
996478592 5:123948852-123948874 GTATTTACAGACCTTGAGCTAGG + Intergenic
997459815 5:134044294-134044316 ATATGATGGGAGCTGGAGCTAGG - Intergenic
999617929 5:153444792-153444814 ACATGAAAAGTGCATGAGCTTGG + Intergenic
1004471064 6:15929497-15929519 ACATGGAAAGAGCCTGAGCTTGG - Intergenic
1006359759 6:33580600-33580622 AGATGAACAGAGGCTCAGCTGGG + Intergenic
1007164801 6:39821701-39821723 ATCTGAACATAGCTGGAGCCTGG + Intronic
1009311252 6:62155530-62155552 ATATGCATAGATCTTGACCTAGG - Intronic
1013948679 6:115753116-115753138 ATATGAGCAGAGTTTGTTCTTGG - Intergenic
1014394806 6:120913533-120913555 ATATAAACAGAGTTTTAACTAGG - Intergenic
1015599566 6:134899368-134899390 ATAGGAACAGAGTTTCAGTTTGG - Intergenic
1015982054 6:138849310-138849332 ATATGAACACAGCGTAACCTTGG + Exonic
1017567025 6:155698367-155698389 TCATTAACAGAGCCTGAGCTGGG - Intergenic
1018111923 6:160544625-160544647 ATGTGAAGGGACCTTGAGCTGGG - Intronic
1018745266 6:166756924-166756946 ATGGGAACAGAGCTTCAGTTTGG + Intronic
1019711240 7:2519218-2519240 ATTTGTACAGAGCAAGAGCTTGG - Intronic
1019983661 7:4639931-4639953 ATAGGGACAGAGTTTGAGTTTGG - Intergenic
1025791377 7:64690350-64690372 ATCTGAACAGAACTGCAGCTGGG - Exonic
1028539167 7:91923602-91923624 ATAATAACAGAGCTGGAGCTGGG + Intergenic
1029176619 7:98669305-98669327 ATATGAACAGAGATGAGGCTGGG + Intergenic
1030375414 7:108747807-108747829 ATATACAAAGAACTTGAGCTTGG + Intergenic
1031483921 7:122306599-122306621 AAAGGAAGAGAGCTTGGGCTGGG + Intronic
1031500308 7:122506368-122506390 ATATGAACAGACTTTAATCTGGG + Intronic
1033478331 7:141712488-141712510 ATATGAAAAGAACTTCTGCTTGG - Intronic
1034554207 7:151839712-151839734 CTATGGACAGAGCTAGAGCCTGG - Intronic
1037831384 8:22191788-22191810 CTATGAAGAGAGCTGGAGCCAGG + Intronic
1042138984 8:65660518-65660540 ATTTGTACTCAGCTTGAGCTTGG + Intronic
1042503916 8:69539424-69539446 ATATGAAAAGATCTTGCGCTTGG + Intronic
1047345094 8:124020138-124020160 AAATAAACAGAGCTTGTGCAGGG - Intronic
1047945879 8:129879415-129879437 ACATGCACAGACCTTGAGCAGGG - Exonic
1047953370 8:129954139-129954161 ATAAGACCAGAGCTTGGGCAAGG - Intronic
1050065950 9:1759638-1759660 ATCTGAACAGAGGGAGAGCTGGG - Intergenic
1051176725 9:14368211-14368233 AAATGAAGAGAGCTTGAACTAGG + Intronic
1051539826 9:18203129-18203151 GTATAAACAGAGCATGAGCACGG - Intergenic
1051652947 9:19348359-19348381 ATATGAAAAGAGGTTCAGGTTGG + Intronic
1051897845 9:22007062-22007084 ATATAAAAAGAGCTTGGGCCAGG + Intronic
1053422339 9:37987539-37987561 ATCCGGACAGAGCTGGAGCTGGG - Intronic
1053556251 9:39140038-39140060 AAATGAACACTGCTTGGGCTGGG - Intronic
1053671361 9:40367143-40367165 ATATGCACATGGCTTGACCTTGG - Intergenic
1053921171 9:42993517-42993539 ATATGCACATGGCTTGACCTGGG - Intergenic
1054382473 9:64507193-64507215 ATATGCACATGGCTTGACCTTGG - Intergenic
1054513255 9:66009167-66009189 ATATGCACATGGCTTGACCTTGG + Intergenic
1055328345 9:75155772-75155794 ATGTGGAAAGAGCCTGAGCTAGG - Intergenic
1057149121 9:92780607-92780629 ATTTATACAGAGCTTGAGTTGGG - Intergenic
1057622454 9:96648196-96648218 ATAAGAAGAGAGTTTGGGCTGGG - Intronic
1058730583 9:107846204-107846226 AGATGAAGGGGGCTTGAGCTAGG + Intergenic
1062427886 9:136514416-136514438 ACCTGCACAGAGCTTGAGATGGG - Intronic
1188396488 X:29690284-29690306 ATATGTACAGAGCTTTAGTGAGG + Intronic
1188692812 X:33151106-33151128 ACATGAACAGGGCTTTATCTTGG - Intronic
1189009696 X:37034829-37034851 AATAGAACAGAGCTTGAGCTGGG + Intergenic
1189038872 X:37520887-37520909 AATAGAACAGAGCTTGAGCCGGG - Intronic
1191833019 X:65435223-65435245 ATTTATACAGTGCTTGAGCTAGG + Intronic
1193454224 X:81709771-81709793 ATATGAAAACACCATGAGCTTGG + Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1194870475 X:99125474-99125496 ATTTGTGCAGTGCTTGAGCTGGG - Intergenic
1197256392 X:124267977-124267999 ATATGGACAGTGACTGAGCTTGG - Intronic
1197596887 X:128475053-128475075 ATATGAACATAGTTTGAGCCAGG - Intergenic