ID: 908831518

View in Genome Browser
Species Human (GRCh38)
Location 1:68183417-68183439
Sequence AAGAACTATCCCTGCTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908831518_908831520 19 Left 908831518 1:68183417-68183439 CCATCATAGCAGGGATAGTTCTT 0: 1
1: 0
2: 3
3: 13
4: 121
Right 908831520 1:68183459-68183481 GCCCCATTCAGCTCTCTTTATGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908831518 Original CRISPR AAGAACTATCCCTGCTATGA TGG (reversed) Intronic
902031815 1:13428485-13428507 CAGAACCATCCCTGCGCTGACGG + Intergenic
906273991 1:44502583-44502605 AAGAGCTGTCCCTGCCCTGAAGG + Intronic
907558769 1:55368769-55368791 AAGTAATATCCCTGGTGTGAGGG + Intergenic
908831518 1:68183417-68183439 AAGAACTATCCCTGCTATGATGG - Intronic
909566243 1:77056599-77056621 AAGAACTTTCCCTGTTAGGCTGG - Intronic
912322261 1:108725137-108725159 AAGAATTTTCCATGCTATGGAGG + Intronic
915004774 1:152625812-152625834 AAGTACTTTCCCTGCTCTGAAGG - Intergenic
917276630 1:173338218-173338240 AAGAGCTGTCCCTTCCATGATGG - Intergenic
1062923959 10:1300294-1300316 AAGAACCATCCCTGCTGCGAGGG - Intronic
1064633245 10:17338527-17338549 AACAACTATCTATGCTATGGTGG - Intronic
1065122252 10:22541712-22541734 AAGCACTACCCCAGTTATGAGGG - Intronic
1067847037 10:49732819-49732841 AAGAACTAACCCTGGGATGCCGG - Intergenic
1068723751 10:60277157-60277179 CAGAGCTATCACTGCTATGTCGG + Intronic
1069522308 10:69133006-69133028 AAACACTATCTCTTCTATGACGG + Exonic
1069824572 10:71247210-71247232 AAGGCCTATCCCTGCCCTGAAGG + Intronic
1072970756 10:100015402-100015424 AAGTACTATCACGGTTATGAGGG + Intergenic
1073479431 10:103777278-103777300 AAGCACTTTCCCTGGCATGAGGG - Intronic
1076275050 10:129191666-129191688 AAGGACTCTCACTGGTATGAAGG - Intergenic
1076651746 10:131994334-131994356 AAGCACTACCCCTTCTATGCTGG - Intergenic
1081836619 11:46160673-46160695 CAGAAAAATCCCTGCTATCAGGG + Intergenic
1083228293 11:61298664-61298686 AAGAAGCATCCCTGGTTTGAGGG - Intergenic
1084581324 11:70025295-70025317 TAGCACTATGCCTGTTATGAAGG + Intergenic
1087668419 11:101077311-101077333 AAGCACTATCAGTGCTATAAAGG - Intronic
1091693437 12:2612127-2612149 AAGGACCATCCCTGCTCCGATGG + Intronic
1092793141 12:12086734-12086756 AAGAAATATCCCTGCTCTCAGGG - Intronic
1102559739 12:113753752-113753774 AAGAACTACCTGTGCCATGAGGG + Intergenic
1104300665 12:127562325-127562347 AAGAACTATTACTGCGAGGAAGG - Intergenic
1106696321 13:32177665-32177687 AAGCACAATCCCTTTTATGAAGG - Intronic
1109932776 13:69237003-69237025 AAGAAATATTCCTGTTATGTAGG - Intergenic
1112965278 13:105183817-105183839 TTTAACCATCCCTGCTATGATGG - Intergenic
1114684719 14:24517788-24517810 AAGAACTATCCCAGATTTAAGGG - Intergenic
1115223592 14:31081382-31081404 GAGAACTTTCTCTGCTATCAAGG - Intronic
1116097360 14:40387793-40387815 AATAACAATCCCTGCAAGGAGGG - Intergenic
1116642280 14:47479631-47479653 ATGAAATATCCCTGTAATGAAGG - Intronic
1119887674 14:78156932-78156954 AAGAAAAATCCCTGCTCTCAAGG + Intergenic
1121023871 14:90600157-90600179 GAGAAATATGCCTGCTTTGAGGG - Intronic
1126437343 15:48648640-48648662 AAGAACTATTCCCGCTATCTAGG + Intergenic
1131944908 15:97609117-97609139 CAGAACACTCCCAGCTATGATGG + Intergenic
1132685137 16:1158988-1159010 AAGGACGATCCCAGCGATGAAGG - Intronic
1133396056 16:5448436-5448458 AATAACTATCTCTCCTATGTGGG + Intergenic
1134618110 16:15667510-15667532 AAGAAGGAACCCTGCAATGAGGG + Intronic
1139149077 16:64358954-64358976 AAGATCTATTCATGTTATGATGG + Intergenic
1143551992 17:7636036-7636058 AAACACTATCCCCGCTCTGATGG + Intergenic
1144035739 17:11363947-11363969 AAGGAGTATCCCTGCTCTGCAGG + Intronic
1146335135 17:31963342-31963364 AAGAACCATCCTTGCTAACACGG - Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1153606186 18:6835964-6835986 ATAAACTAACCCTGCTCTGATGG + Intronic
1156064434 18:33122460-33122482 CAGCATTATGCCTGCTATGAAGG - Intronic
1156673864 18:39504221-39504243 TGGAACTATCCTTTCTATGAAGG + Intergenic
1157851185 18:51052424-51052446 AACAAATATCCCTGCTGTCATGG - Intronic
1159488937 18:69103988-69104010 AAGCACTATCCATGCTATGGAGG + Intergenic
1160370109 18:78365011-78365033 GAGAAATATCCCTGCTATGATGG + Intergenic
925880015 2:8344856-8344878 AAGAACAATCCCAGCAAGGAAGG - Intergenic
928938486 2:36704517-36704539 GGGAACAATCCCTGCTCTGAAGG - Intronic
934167613 2:89309187-89309209 AAGAACTTTCACTGGGATGAAGG + Intergenic
934199671 2:89873396-89873418 AAGAACTTTCACTGGGATGAAGG - Intergenic
939672526 2:145030679-145030701 AAGAATTATCCCTTATATTAAGG + Intergenic
942438245 2:176004050-176004072 AACAACTATTCTTGATATGAAGG - Intergenic
942759246 2:179378954-179378976 AATAACTCTGCCTGCTATGTAGG - Intergenic
944318463 2:198308539-198308561 AAGAATTATCCCTGTTTTGCTGG + Intronic
946000358 2:216477035-216477057 AGGAACCATACCTGCTATGGTGG + Intronic
946430124 2:219621632-219621654 AAGAACTGGCCATGCCATGAAGG - Intergenic
947202367 2:227626031-227626053 AAGAAATATCCCTGTTATTAAGG - Intronic
1170354459 20:15477251-15477273 AAGAAGTTTGCCTGCTATGGTGG - Intronic
1173295613 20:41753159-41753181 AAAAACTTTCCAGGCTATGAAGG - Intergenic
1173963666 20:47094375-47094397 AAGAAATATACTTACTATGATGG + Intronic
1174892369 20:54409882-54409904 AAAAATTTTCCCTGCTTTGAAGG - Intergenic
1177686620 21:24445578-24445600 AAGAAGTATCTCTGCTATAAAGG + Intergenic
1178692274 21:34760060-34760082 AAGAAAGACACCTGCTATGACGG - Intergenic
1181406433 22:22688174-22688196 AAGAGCTATTCCTGCCATGATGG + Intergenic
1181422759 22:22813178-22813200 AAGAGCTATCCCTGCCATGAAGG + Intronic
953808991 3:46095986-46096008 AAGCCCTATGCCTGCTATCAAGG + Intergenic
954770152 3:52959828-52959850 AACAACCATCCCTGCTCTTAGGG - Intronic
955472355 3:59298764-59298786 AGGATCTATCCCTGCACTGAGGG + Intergenic
957900849 3:86487938-86487960 AAAAACTATCTCTGTCATGAAGG - Intergenic
961096674 3:124162587-124162609 AAGCACTATTCCAGCTCTGAGGG - Intronic
961314605 3:126026065-126026087 AAGACCTGTCCCTGCTCTGCAGG - Intronic
963710948 3:148746900-148746922 CAGAACTATTCCTGCGATGAGGG - Intergenic
969723040 4:8903854-8903876 AAGAACTACCCCTGCAGTGCTGG - Intergenic
971067593 4:23051303-23051325 AATGGGTATCCCTGCTATGACGG + Intergenic
971147631 4:23996112-23996134 AAGCACTTTCACAGCTATGATGG + Intergenic
971617674 4:28813246-28813268 AAGAACTATCCTGTCTATGCAGG + Intergenic
973930345 4:55786669-55786691 TAGAACAATTCCAGCTATGATGG - Intergenic
975310046 4:72893728-72893750 AAGATCTTTCACAGCTATGATGG + Intergenic
977346316 4:95821137-95821159 AAGTTCTTTCCCTCCTATGAGGG - Intergenic
977438681 4:97035293-97035315 AGGAACTGTCCCTGCCCTGAAGG - Intergenic
979795968 4:124847108-124847130 ATCAACTATCCCTTCTATGATGG + Intergenic
982641446 4:157966881-157966903 AAGAAGTATGCCTACTTTGAAGG + Intergenic
982860767 4:160446048-160446070 AAAAACTATGCCTTCTAAGATGG - Intergenic
987730531 5:21765357-21765379 GTGAACTAACCCTGGTATGATGG - Intronic
990675418 5:58178813-58178835 AAAAACTATCACTTTTATGAGGG + Intergenic
992381851 5:76245303-76245325 AAGGACTAGCCCTGCTAGAATGG + Intronic
993409195 5:87553628-87553650 AAGCACTTTCCCTTCCATGATGG + Intergenic
997023563 5:130030942-130030964 AAAAACTATCCCTGATTTGTAGG - Intronic
997701529 5:135904298-135904320 AAGAAAAATCCTTGCTATGGAGG - Intergenic
1000190019 5:158901378-158901400 AAACACTATCCCTGCTGTCATGG - Intronic
1000492408 5:161930730-161930752 AAGAACAATGCCTTCAATGACGG - Intergenic
1002360860 5:178669742-178669764 AGGAACTTTCCCTGGTATGTTGG + Intergenic
1006481599 6:34299350-34299372 AAGAATTATCTCTACTAAGATGG - Intronic
1008098285 6:47362964-47362986 TAGAACTATGCCTGGTATGTTGG - Intergenic
1009828670 6:68900799-68900821 AAGCACTGTTCCTTCTATGATGG - Intronic
1010732784 6:79408914-79408936 AAGAACTATTCCTTCTATGAAGG - Intergenic
1011248840 6:85348824-85348846 TTGCACTATCCCTGCGATGAGGG - Intergenic
1012236367 6:96820879-96820901 AAGAAATACCACTGATATGATGG - Intronic
1014135809 6:117888188-117888210 AAAGACTATCTCTGCTTTGAAGG - Intergenic
1017047274 6:150358909-150358931 AAGAAGTATCCCAGCTCAGATGG - Intergenic
1017510940 6:155113779-155113801 AAGAAGTATCCCTGCTCTCATGG - Intronic
1019220949 6:170472410-170472432 CAGAGCTATGCCTGCTATCAAGG - Intergenic
1022438363 7:30411440-30411462 AACAACTGTCCCTGCTAGGAGGG + Intronic
1027546351 7:79531871-79531893 AAGCACTACCCCTCCCATGATGG + Intergenic
1028289065 7:89042666-89042688 CAGAGCTAGCCCTGCTCTGAAGG + Intronic
1028733621 7:94181413-94181435 AAGAACTATACCTGCATTTAAGG - Intergenic
1029374638 7:100170364-100170386 CAGAACCATCCCTTCTAGGAGGG + Exonic
1034336799 7:150329192-150329214 CAGAAGTATTCCTGCTATGCAGG + Intronic
1035530363 8:346112-346134 AAGAAAGTTCCCTGCTCTGAAGG + Intergenic
1039205798 8:35152811-35152833 AAGAACTATGCCTGGTAAGCAGG - Intergenic
1039393978 8:37207028-37207050 AAGTGTCATCCCTGCTATGAGGG - Intergenic
1041864303 8:62551805-62551827 CAGAAATATCTCTGATATGAAGG - Intronic
1044043029 8:87393712-87393734 AAGAACTATGCCTGAGAAGAGGG + Intronic
1044876433 8:96672369-96672391 GAGAAATATCCCTGCCTTGATGG + Intronic
1047188314 8:122655504-122655526 AAGTGCTAGGCCTGCTATGAAGG + Intergenic
1048279650 8:133095661-133095683 AAGAACTTTGCATGCTATAAAGG - Intronic
1050425906 9:5512425-5512447 ATGAACTGCCCCTGCTTTGAGGG + Intronic
1053347668 9:37389768-37389790 CAGAATTTTCCCTGGTATGAGGG + Intergenic
1056536957 9:87536915-87536937 AACAACTATTACTGCTCTGATGG - Intronic
1057173287 9:92976518-92976540 GAGAACTTTCCCTGCGAGGAGGG + Exonic
1061644585 9:131990436-131990458 AAAAACTATCACTGCCATGAGGG + Intronic
1186455811 X:9708978-9709000 AAAAACCTTCCCTGCTAGGAAGG - Intronic
1188656818 X:32707347-32707369 AAAAACTATCCCAGCGAAGAGGG - Intronic
1189172724 X:38925208-38925230 AACCAGAATCCCTGCTATGATGG + Intergenic
1194956212 X:100183830-100183852 AGGTACTATTCCTGCCATGAAGG - Intergenic
1196886939 X:120255227-120255249 AAGCACTATTCCTGCAATGAAGG + Exonic
1198523840 X:137479834-137479856 TGGAACTATCCCTGATATTAAGG - Intergenic
1199520150 X:148726162-148726184 ATGCTCTATCCCTGCCATGAGGG + Intronic
1199879972 X:151966296-151966318 AGCAACTATCGATGCTATGATGG + Intronic
1202258164 Y:22941892-22941914 AAGAGCTATCCCTGCTCTCTTGG - Intergenic
1202411154 Y:24575650-24575672 AAGAGCTATCCCTGCTCTCTTGG - Intergenic
1202459627 Y:25094422-25094444 AAGAGCTATCCCTGCTCTCTTGG + Intergenic