ID: 908832077

View in Genome Browser
Species Human (GRCh38)
Location 1:68189613-68189635
Sequence AAGACTAATCTCACTAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908832072_908832077 24 Left 908832072 1:68189566-68189588 CCCCTGTGGATAAGGAAGACTTA 0: 1
1: 0
2: 1
3: 12
4: 183
Right 908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG 0: 1
1: 0
2: 0
3: 3
4: 101
908832073_908832077 23 Left 908832073 1:68189567-68189589 CCCTGTGGATAAGGAAGACTTAC No data
Right 908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG 0: 1
1: 0
2: 0
3: 3
4: 101
908832075_908832077 1 Left 908832075 1:68189589-68189611 CCTCTACCACGTGCTTCTTTTAT 0: 1
1: 0
2: 0
3: 7
4: 136
Right 908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG 0: 1
1: 0
2: 0
3: 3
4: 101
908832076_908832077 -5 Left 908832076 1:68189595-68189617 CCACGTGCTTCTTTTATAAAGAC 0: 1
1: 0
2: 1
3: 34
4: 271
Right 908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG 0: 1
1: 0
2: 0
3: 3
4: 101
908832074_908832077 22 Left 908832074 1:68189568-68189590 CCTGTGGATAAGGAAGACTTACC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG 0: 1
1: 0
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908832077 Original CRISPR AAGACTAATCTCACTAACCA AGG Intronic
900808931 1:4786519-4786541 AAGACCAATCCCTCTAAGCATGG - Exonic
903361638 1:22780785-22780807 CAGTCTAGTCTCACTAACCTAGG - Intronic
906467333 1:46094384-46094406 AAGACTAATCAAGCTAACCAAGG + Intronic
908832077 1:68189613-68189635 AAGACTAATCTCACTAACCAAGG + Intronic
909321312 1:74289475-74289497 AAGACTAATGACACTACCTATGG - Intronic
909879250 1:80852318-80852340 AAGTCTAATCTCATTAAGAATGG + Intergenic
913027304 1:114856618-114856640 AAGACTAATCTCTCCAAAAATGG + Exonic
915603984 1:156939487-156939509 AAGACTTATCTCACCTAGCAAGG + Intronic
918030856 1:180808775-180808797 AAGACTAATCATACTAATGATGG + Intronic
922916657 1:229263546-229263568 AAGCCTCATCTCACTCACAATGG - Intergenic
923173155 1:231435692-231435714 AAAATTAATATTACTAACCAAGG + Intergenic
1068617507 10:59135746-59135768 AAGCCTAATGACACTGACCAAGG - Intergenic
1071046258 10:81382221-81382243 TAAAATAGTCTCACTAACCAAGG - Intergenic
1073769686 10:106722576-106722598 AGGACTAATCTCATTCACCGGGG - Intronic
1074275557 10:111998599-111998621 AAGACTAATCTCCCAGGCCATGG - Intergenic
1074847031 10:117407389-117407411 AAGGCCGATCCCACTAACCAAGG - Intergenic
1076265058 10:129103301-129103323 AAGACTGACCTCCCTAAGCAAGG + Intergenic
1079416590 11:20243496-20243518 AGGACCAATCTCATTAACCCCGG + Intergenic
1080081668 11:28226837-28226859 GTTACTAATCTTACTAACCATGG + Intronic
1081754609 11:45535775-45535797 AAGCCCAATCTCACTCTCCAGGG + Intergenic
1085645319 11:78218819-78218841 AAGACAAGTCTCACCAACCCAGG - Exonic
1087640345 11:100749404-100749426 AAGACTAAACCCTCAAACCAGGG + Intronic
1094764121 12:33572540-33572562 TAGCATAATCTCACTAACAATGG - Intergenic
1106521947 13:30506068-30506090 AAGACTAAACTGGCTGACCAAGG + Intronic
1107274663 13:38664896-38664918 AAGACTGATCCCAGGAACCAAGG + Intergenic
1107766207 13:43737552-43737574 AGAACTGATCTCACTAGCCAAGG + Intronic
1109233517 13:59787851-59787873 AGCACTAATCTCATTAACAAAGG - Intronic
1109752876 13:66719396-66719418 AACACTAATCTCACTCATGAGGG - Intronic
1110794488 13:79620747-79620769 AAGACTAAACTCACTAGAAAGGG - Intergenic
1128761864 15:70222347-70222369 ATCACTAATCTCACCATCCATGG + Intergenic
1129919245 15:79305702-79305724 AAGACAAATCTCATTCACCTTGG + Intergenic
1134353575 16:13460717-13460739 AATATGAATCTCACTAACCTTGG - Intergenic
1137260262 16:46821533-46821555 AAGACCACTCTTACTAAACAAGG + Intronic
1138145357 16:54604283-54604305 AAAACCAACCTCTCTAACCAGGG + Intergenic
1140876679 16:79159204-79159226 TAGACTAATCTCAATTACCAGGG + Intronic
1148917310 17:50992801-50992823 AAGACTAATCTGACTGCCCGGGG + Intronic
1156245553 18:35294374-35294396 ATGACTGATCTCAATTACCAAGG - Intergenic
1158008935 18:52706338-52706360 AAGAGGAATCTCACAGACCAAGG + Intronic
1158828052 18:61246668-61246690 AAGACTGCTCTCACTTACAAAGG + Intergenic
940561376 2:155301544-155301566 AAGACTTTTCTCACTCTCCATGG + Intergenic
942912870 2:181266621-181266643 AAGAATACTCTTACTATCCATGG + Intergenic
944414408 2:199468347-199468369 AAGACTAACCTCAGTATCAAAGG + Intronic
1171000192 20:21406808-21406830 AAGAATAGTCTCATTAACAACGG - Intergenic
1171403667 20:24895206-24895228 AAGACTAATTTTACCCACCAAGG + Intergenic
1175741406 20:61422134-61422156 AAGACAAATCTCACTGGGCACGG + Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178102975 21:29290258-29290280 AAGAGTAAACTCAGTAACCAGGG + Intronic
949804585 3:7940958-7940980 CAGACTAATTTCATTACCCAAGG + Intergenic
950830827 3:15874337-15874359 CAGCCAAAACTCACTAACCAAGG - Intergenic
951874058 3:27401151-27401173 GAGACTAATCTTGCTAAACATGG - Intronic
952279146 3:31906531-31906553 AAAACTACTCTCCATAACCAGGG + Intronic
952302828 3:32119689-32119711 ATGAATAATCTCACCACCCAGGG - Intronic
952482117 3:33772277-33772299 AAGAAGAATCTCACTAATCTTGG + Intergenic
956641224 3:71417318-71417340 AAGTCTAAAATCAATAACCATGG - Intronic
959738416 3:109687625-109687647 AATAGTAATCTCAATAATCAAGG + Intergenic
959780467 3:110226789-110226811 AATAATAATTTGACTAACCAAGG - Intergenic
960690426 3:120341622-120341644 AACACTAATCCCATTAACGAGGG - Intronic
962330331 3:134472538-134472560 AAAACTAGCCTCACTGACCATGG - Intergenic
963808417 3:149749912-149749934 ATGCCTAATATCCCTAACCAAGG + Intronic
966692666 3:182757758-182757780 AAGAATAAACTCCCTAACTATGG - Intergenic
970292175 4:14585094-14585116 GATACTAATCTCATTGACCAGGG + Intergenic
971860426 4:32095523-32095545 TAAGCTTATCTCACTAACCATGG + Intergenic
974552558 4:63396994-63397016 GACACTATTCTCACTCACCAGGG - Intergenic
981097606 4:140797962-140797984 AAGACTAATATCATTAGTCAAGG + Intergenic
986090971 5:4505937-4505959 AAGACTACAATCACTAATCAGGG - Intergenic
989262975 5:39439223-39439245 AACACTAATCCAAATAACCAAGG - Intronic
994950547 5:106455720-106455742 CAGACTCAGCTCACTAACTAGGG + Intergenic
995899166 5:117048550-117048572 AATTCTGACCTCACTAACCATGG + Intergenic
1001846490 5:174926390-174926412 AAAATTAATCACACAAACCACGG - Intergenic
1004150697 6:13117286-13117308 AACCCTAAACTCACTAAACATGG - Intronic
1007712471 6:43833550-43833572 AAGTCTAATCTCACCAAACCTGG - Intergenic
1008074197 6:47128835-47128857 AATAGTTATCTTACTAACCATGG + Intergenic
1009634099 6:66241581-66241603 AAGATTAATCTCCCAAATCATGG + Intergenic
1011466610 6:87664329-87664351 AATACTAATACCACTTACCAGGG - Intronic
1013484772 6:110586272-110586294 AAGTCTAATCTCATTAACATGGG - Intergenic
1014192428 6:118512676-118512698 AAGACTCATCTTACAAACCCTGG - Intronic
1015701035 6:136036504-136036526 AAAACTAAACTTATTAACCATGG + Intronic
1018921185 6:168176748-168176770 AAGAGTAATCTCTCAAACCCAGG - Intergenic
1021958675 7:25852127-25852149 ATGGCTAATCTCACCAACCCTGG + Intergenic
1026615460 7:71898815-71898837 AAGACTCATCTCAACAACAATGG + Intronic
1032621448 7:133537624-133537646 AAGACTACAGTCACTGACCATGG - Intronic
1036750688 8:11442071-11442093 AGGACTAATCTGACTACCAAAGG - Intronic
1038360970 8:26876879-26876901 AAGACTAAGCTTACTAAACTTGG + Intergenic
1041443226 8:57920947-57920969 AAGATTATTCTAAGTAACCATGG + Intergenic
1044750599 8:95411862-95411884 AAGCCTATTCTCTCTAAGCATGG + Intergenic
1046430528 8:114120765-114120787 AAGGCTTATTTCACTCACCAAGG + Intergenic
1046873749 8:119230973-119230995 AGGACAAATTTAACTAACCATGG - Intronic
1047836187 8:128695734-128695756 AAGCCTGATCTCTCTAGCCAAGG - Intergenic
1048880926 8:138871961-138871983 CAGACTAATCTCCCTGATCATGG + Intronic
1052300581 9:26948127-26948149 AAGAATGATCTCCCAAACCAGGG - Intronic
1053607310 9:39673445-39673467 AGGTCTAATCTCATCAACCATGG - Intergenic
1053865164 9:42429800-42429822 AGGTCTAATCTCATCAACCATGG - Intergenic
1054246224 9:62668964-62668986 AGGTCTAATCTCATCAACCATGG + Intergenic
1054560345 9:66703497-66703519 AGGTCTAATCTCATCAACCATGG + Intergenic
1188918447 X:35941365-35941387 GAGATTACTATCACTAACCATGG + Exonic
1189124328 X:38430018-38430040 AAGACTTATCCCATTAACAAGGG + Intronic
1189533994 X:41917458-41917480 AAGAATAATCTCAAGAAGCAAGG + Intronic
1190964693 X:55287972-55287994 AAGACTCATCTCACATACAAAGG - Intronic
1196891982 X:120300091-120300113 AAGGCTTGTCTCACTATCCAGGG + Intronic
1197747372 X:129940602-129940624 CAGACCAATCTCCCTAACCCTGG - Intergenic
1198604659 X:138323458-138323480 AAGATTTATCTCACTAATAAAGG + Intergenic