ID: 908834149

View in Genome Browser
Species Human (GRCh38)
Location 1:68211705-68211727
Sequence CTCATGAGTGGTGAGAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908834149_908834153 14 Left 908834149 1:68211705-68211727 CCCCATTTCTCACCACTCATGAG No data
Right 908834153 1:68211742-68211764 ATCACAAATCTGCCACCATGTGG 0: 1
1: 0
2: 0
3: 20
4: 200
908834149_908834156 27 Left 908834149 1:68211705-68211727 CCCCATTTCTCACCACTCATGAG No data
Right 908834156 1:68211755-68211777 CACCATGTGGATCTTGGACATGG 0: 1
1: 0
2: 8
3: 18
4: 155
908834149_908834154 21 Left 908834149 1:68211705-68211727 CCCCATTTCTCACCACTCATGAG No data
Right 908834154 1:68211749-68211771 ATCTGCCACCATGTGGATCTTGG No data
908834149_908834157 28 Left 908834149 1:68211705-68211727 CCCCATTTCTCACCACTCATGAG No data
Right 908834157 1:68211756-68211778 ACCATGTGGATCTTGGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908834149 Original CRISPR CTCATGAGTGGTGAGAAATG GGG (reversed) Intronic
No off target data available for this crispr