ID: 908834855

View in Genome Browser
Species Human (GRCh38)
Location 1:68218725-68218747
Sequence ACAGCTTGTGTGCAGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908834850_908834855 10 Left 908834850 1:68218692-68218714 CCGTTCCTCTTTGCCTGCAGGCA 0: 1
1: 0
2: 3
3: 39
4: 424
Right 908834855 1:68218725-68218747 ACAGCTTGTGTGCAGGAACCTGG No data
908834848_908834855 13 Left 908834848 1:68218689-68218711 CCTCCGTTCCTCTTTGCCTGCAG 0: 1
1: 0
2: 1
3: 27
4: 267
Right 908834855 1:68218725-68218747 ACAGCTTGTGTGCAGGAACCTGG No data
908834853_908834855 -3 Left 908834853 1:68218705-68218727 CCTGCAGGCAGACATTTGGCACA 0: 1
1: 0
2: 0
3: 16
4: 162
Right 908834855 1:68218725-68218747 ACAGCTTGTGTGCAGGAACCTGG No data
908834851_908834855 5 Left 908834851 1:68218697-68218719 CCTCTTTGCCTGCAGGCAGACAT No data
Right 908834855 1:68218725-68218747 ACAGCTTGTGTGCAGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908834855 Original CRISPR ACAGCTTGTGTGCAGGAACC TGG Intronic
No off target data available for this crispr