ID: 908843852

View in Genome Browser
Species Human (GRCh38)
Location 1:68304857-68304879
Sequence TAGGATGAAGATAATGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908843852_908843858 10 Left 908843852 1:68304857-68304879 CCTCCACCATTATCTTCATCCTA No data
Right 908843858 1:68304890-68304912 CCTCTCCTCTCCCCTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908843852 Original CRISPR TAGGATGAAGATAATGGTGG AGG (reversed) Intergenic
No off target data available for this crispr