ID: 908846300

View in Genome Browser
Species Human (GRCh38)
Location 1:68327957-68327979
Sequence CTGAAAGGGCTTCCTAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908846297_908846300 2 Left 908846297 1:68327932-68327954 CCATTTTCAAATATTTACAATAG No data
Right 908846300 1:68327957-68327979 CTGAAAGGGCTTCCTAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908846300 Original CRISPR CTGAAAGGGCTTCCTAACTC AGG Intergenic