ID: 908848664

View in Genome Browser
Species Human (GRCh38)
Location 1:68351023-68351045
Sequence AGACTAAGCAGACCAGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908848653_908848664 29 Left 908848653 1:68350971-68350993 CCCATCCCTTCCTTCCAAAATGC No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848655_908848664 24 Left 908848655 1:68350976-68350998 CCCTTCCTTCCAAAATGCTTTTC No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848657_908848664 19 Left 908848657 1:68350981-68351003 CCTTCCAAAATGCTTTTCCCTAA No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848661_908848664 1 Left 908848661 1:68350999-68351021 CCTAAGTTTTGTTAGGAAACCCT No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848660_908848664 2 Left 908848660 1:68350998-68351020 CCCTAAGTTTTGTTAGGAAACCC No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848654_908848664 28 Left 908848654 1:68350972-68350994 CCATCCCTTCCTTCCAAAATGCT No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848658_908848664 15 Left 908848658 1:68350985-68351007 CCAAAATGCTTTTCCCTAAGTTT No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data
908848656_908848664 23 Left 908848656 1:68350977-68350999 CCTTCCTTCCAAAATGCTTTTCC No data
Right 908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908848664 Original CRISPR AGACTAAGCAGACCAGAAGC TGG Intergenic
No off target data available for this crispr