ID: 908850962

View in Genome Browser
Species Human (GRCh38)
Location 1:68375267-68375289
Sequence CAGCTCCCACAGACTTCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908850957_908850962 12 Left 908850957 1:68375232-68375254 CCTGTCAGACTGGGCTCTTTTCC No data
Right 908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG No data
908850956_908850962 15 Left 908850956 1:68375229-68375251 CCACCTGTCAGACTGGGCTCTTT No data
Right 908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG No data
908850958_908850962 -9 Left 908850958 1:68375253-68375275 CCTTTCCCTCTCCTCAGCTCCCA No data
Right 908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908850962 Original CRISPR CAGCTCCCACAGACTTCCTT CGG Intergenic
No off target data available for this crispr