ID: 908853861

View in Genome Browser
Species Human (GRCh38)
Location 1:68400947-68400969
Sequence CTAAATATTGAGAAGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908853858_908853861 10 Left 908853858 1:68400914-68400936 CCAGAATGGCTAACATTAAAAAG No data
Right 908853861 1:68400947-68400969 CTAAATATTGAGAAGGATATAGG No data
908853857_908853861 11 Left 908853857 1:68400913-68400935 CCCAGAATGGCTAACATTAAAAA No data
Right 908853861 1:68400947-68400969 CTAAATATTGAGAAGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908853861 Original CRISPR CTAAATATTGAGAAGGATAT AGG Intergenic
No off target data available for this crispr