ID: 908855404

View in Genome Browser
Species Human (GRCh38)
Location 1:68421239-68421261
Sequence TTTTTGTTGTAACCAAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908855403_908855404 15 Left 908855403 1:68421201-68421223 CCTTATCTTAAATTTCATTTGTC No data
Right 908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908855404 Original CRISPR TTTTTGTTGTAACCAAAACC TGG Intergenic
No off target data available for this crispr